Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,201-6,2206,221-6,2406,241-6,260 ... 19,241-19,257 next last

Russian Offensive Campaign Assessment, September 11, 2024

The People’s Republic of China (PRC) continues to promote its alternative peace plan for the war in Ukraine. PRC Foreign Minister Wang Yi met with Russian Security Council Secretary Sergei Shoigu in St. Petersburg on September 11 and reiterated that the PRC will continue to promote its own vision to end Russia’s war in Ukraine and will aim to convince other countries to support the PRC’s peace plan.[21] Shoigu reiterated Russia’s support for the joint PRC-Brazilian peace plan during the meeting.[22] PRC officials have routinely promoted the PRC-Brazilian peace plan and allowed Russian officials to posture themselves as willing to negotiate with Ukraine in good faith despite consistent Kremlin statements outright rejecting negotiations or otherwise indicating that Russia will only negotiate on terms that amount to complete Ukrainian capitulation.[23]

Turkish President Recep Tayyip Erdogan reiterated his support for Ukraine on September 11. Erdogan gave a virtual speech to the Fourth Summit of the International Crimea Platform on September 11 in which he reiterated support for Ukraine’s territorial sovereignty, independence, and autonomy and asserted that Crimea “must be returned” to Ukraine under international law.[24]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-11-2024


6,221 posted on 09/12/2024 12:37:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6174 | View Replies]

To: gleeaikin; SpeedyInTexas; PIF; FtrPilot; blitz128; BeauBo
Was it slavs or slaves?

Russian blogger:
Two conscripts missing in Kursk region found at plant in Dagestan

An extremely unpleasant incident occurred with two conscripts who were considered missing after breaking through the border in Kursk region in early August. According to our sources in the Ministry of Internal Affairs, during the search for illegal migrants at a brick factory in Dagestan, citizens born in 2005 and 2004 were found without documents. During further investigation, it became known that both were illegally taken out of Kursk region in early August.

Now investigators are clarifying who and how essentially condemned the soldiers to slavery. Sources say that the men worked at least 12-14 hours a day, without basic living conditions, wages or contact with loved ones. The work of the enterprise was supervised by a high-ranking official of the Ministry of Defense, who worked in conjunction with a local businessman. This story raises many questions. In particular, how widespread is such a “disappearance of conscripts”? Here it is worth checking each episode when conscripts went missing. Alas, there are hundreds of such cases.

https://t.me/kremlin_secrets/4639

Perhaps back to earlier times:

The term slave has its origins in the word slav. The slavs, who inhabited a large part of Eastern Europe, were taken as slaves by the Muslims of Spain during the ninth century AD.

https://www.bbc.co.uk/worldservice/africa/features/storyofafrica/9chapter1.shtml

6,222 posted on 09/12/2024 1:08:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6220 | View Replies]


6,223 posted on 09/12/2024 1:24:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6178 | View Replies]

To: PIF
Russian blogger

Erdogan started talking about Crimea again. Putin was told that the video was a deepfake.

The day before, Turkish President Erdogan made a statement that Crimea should be returned to Ukraine. He emphasized that Turkey did not recognize the annexation of Crimea and that Ankara insists on returning the peninsula to Ukraine. This, according to him, is a requirement of international law.

One of our interlocutors in the Kremlin noted that he was not surprised by Erdogan’s words. Several other sources emphasized that the official rhetoric of the Turkish leader has not changed over the past few years. He has found a comfortable position for himself where he “helps both ours and yours.”

But then something strange happened. When a review of the foreign press was prepared for Vladimir Putin, Erdogan’s statement was not there. The president emphasized that he had seen the video on television, but (attention!!!) he was convinced that the video with Erdogan was a fake. “He was told that the video was a deepfake. It was made using editing,” a source in the Presidential Administration told us. The source did not specify why this was done.

By the way, many remember that Erdogan had previously proposed “depriving Russia of problems” and taking Crimea under temporary Turkish control. The Kremlin did not agree to this, although this idea of ​​Erdogan’s is occasionally recalled.

https://t.me/kremlin_secrets/4641

This is excellent - hide negative info for Putin ;-)

6,224 posted on 09/12/2024 1:58:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6221 | View Replies]

To: PIF; All

5 years down, only 25 years to go to match Japan’s ‘lost decades’.

BRICS, RICKS, DICKS

“China Stock Selloff Pushes Benchmark to Lowest Since Early 2019”

“Economic gloom, lack of earnings recovery hurt sentiment”

“CSI 300 Index is headed for a record fourth year of losses”

“Chinese stocks fell to the lowest since January 2019, a grim reflection of how investors have lost faith over a recovery in the country’s earnings and economy.

The CSI 300 Index closed down 0.4% on Thursday, taking its slide since a May high to around 14%. The benchmark of onshore shares is also headed for an unprecedented fourth straight year of losses.

Confidence in China’s near-term recovery has dwindled as a years-long property crisis hurts consumption and threatens the country’s growth target of around 5%. In another blow to sentiment, geopolitical tensions are rising ahead of the November US presidential elections. Both candidates firmed up their anti-China rhetoric during the debate that aired Wednesday in Asia.”

https://www.bloomberg.com/news/articles/2024-09-12/china-stock-selloff-pushes-benchmark-to-lowest-since-early-2019


6,225 posted on 09/12/2024 3:22:38 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6224 | View Replies]

To: PIF; All

Peak China

“Western Firms That Flocked to China Are Now Pulling Back”

“As China’s growth slows and the difficulty of doing business there rises, Western companies have stopped plowing money into the country”

“Many global businesses are pushing China down on their list of investment destinations and consolidating operations in the country, citing slower growth and diminishing profits.

The gloomy investment trend was the focus of twin reports this week from the European Union Chamber of Commerce in China and the American Chamber of Commerce in Shanghai.

“The risk of doing business in China has gone up in the past few years and at the same time the market is slowing down,” said Eric Zheng, president of the U.S. group. A poll by the U.S. chamber found the percentage of respondents ranking China as their headquarters’ top investment destination fell to the lowest level since the annual survey began 25 years ago. “

https://www.wsj.com/world/china/western-firms-that-flocked-to-china-are-now-pulling-back-ea2f3c27?mod=hp_lead_pos6


6,226 posted on 09/12/2024 3:43:09 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6225 | View Replies]

To: PIF; All

Shocked I tell Ya

“A growing number of House Republicans say they know how the current government funding drama ends: with a clean continuing resolution (CR) that kicks the shutdown deadline to after Election Day.

The question is how Congress arrives at that conclusion.”

https://thehill.com/homenews/house/4875200-house-republicans-funding-plan-shutdown/


6,227 posted on 09/12/2024 3:50:42 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6226 | View Replies]

To: SpeedyInTexas; marcusmaximus; PIF; BeauBo
"The boat belonging to the GUR was raiding a Russian platform in the Black Sea"

I believe this is "false information" to deceive the ruzzians.

I believe the ruzzians have been flying the same flight profile to launch missiles against Odesa.

The profile is flown at low altitude to avoid Patriot missiles.

The GUR got advance intel that ruzzia was planning a launch and UKF positioned the boat with MANPADs with the expectation the aircraft would fly the same flight path as previous launches.

Kudos to GUR and Kudos to the MANPAD operators.

6,228 posted on 09/12/2024 3:54:19 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6203 | View Replies]

To: FtrPilot

If you can tell what’s going on in this video, let us know.

“Ukraine’s GUR says the Su-30SM was shot down by a MANPADS during an operation in the Black Sea. “

https://x.com/RALee85/status/1834105928502710666


6,229 posted on 09/12/2024 4:14:24 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6228 | View Replies]

To: PIF; All

“The train in the Belgorod region was derailed due to a joint operation by Ukraine’s military intelligence (HUR) and special forces (SSO). On September 10, explosives were planted and detonated on the “Stary Oskol - Valuyki” railway line. The operation successfully derailed a freight train supplying the Russian army, paralyzing the key railway route.”

https://x.com/NOELreports/status/1834136675401822429


6,230 posted on 09/12/2024 4:15:32 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6229 | View Replies]

To: PIF; All

“Omsk, big fire at the Omsktransmash plant.

The plant is involved in the production of TOS-1 Solntsepek, and tank maintenance.”

https://x.com/wartranslated/status/1834150161456472390


6,231 posted on 09/12/2024 4:16:21 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6230 | View Replies]

To: AdmSmith

Before the “SMO” conscripts were sold for labor by their officers.

You don’t become the richest man in the world by being a good civil servant and civil servant wages. Of course our “leaders” enrich themselves as well, but not quite as well

Truman had it right


6,232 posted on 09/12/2024 4:17:26 AM PDT by blitz128
[ Post Reply | Private Reply | To 6222 | View Replies]

To: PIF; All

Vodka?

“Russian military transport vehicle turns over on a highway.”

https://x.com/wartranslated/status/1834137477365264846


6,233 posted on 09/12/2024 4:18:14 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6231 | View Replies]

To: PIF; All

“Early this evening, Ukrainian forces successfully struck a Russian ammunition dump outside of Mariupol.

Multiple large fires and secondary explosions could be seen from nearby as the dump cooked off.”

https://x.com/Osinttechnical/status/1834000935045194237


6,234 posted on 09/12/2024 4:19:11 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6233 | View Replies]

To: SpeedyInTexas

With all the control the Russians have over the information space, I am still amazed by the number of, to say the least, non flattering videos posted by Russians like this video


6,235 posted on 09/12/2024 4:22:58 AM PDT by blitz128
[ Post Reply | Private Reply | To 6233 | View Replies]

To: PIF; All

“The U.S. Department of Defense announced that the Pentagon is allocating ~$1.2 billion for the production of medium-range AMRAAM missiles for sales to countries including Ukraine. These advanced missiles have a range of up to 160 km and use inertial guidance with an active radar system to intercept targets beyond visual range, regardless of weather conditions.”

https://x.com/NOELreports/status/1834097979940372635


6,236 posted on 09/12/2024 4:23:54 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6234 | View Replies]

To: blitz128

“I am still amazed”

But I enjoy the amusement.

Another satisfying day in America!


6,237 posted on 09/12/2024 4:25:23 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6235 | View Replies]

To: PIF; All

Potholes? Maybe, or just more Vodka?

“Anton Gerashchenko @Gerashchenko_en Russian MP Gurulev, who constantly issues threats of strikes Europe, UK and the US, got into a traffic accident in Russia’s Zabaykalsky Krai. And was shocked by how Russians live with such bad roads:

“The suspension was ripped out, the potholes are so bad that you can’t get around. I don’t know how you live. The famous Matsiyevskaya-Krasnokamensk road. It is full of potholes, it is impossible to drive through,” he said.

Russian politicians are so preoccupied with nuclear threats to other states that they barely even notice their own country.”

https://x.com/Gerashchenko_en/status/1834179386892783656


6,238 posted on 09/12/2024 4:27:27 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6237 | View Replies]

To: SpeedyInTexas

Looks like a well traveled road in the Milwaukee ( proudly under Dem control for over a century ) area a few years back - car repair shops loved it, until the county was forced to repair it.


6,239 posted on 09/12/2024 4:53:01 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6238 | View Replies]

To: SpeedyInTexas

Motorcycle give away program begins

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ 3% Survival Rate: Russian Commanders try a New Tactic ]


Today [ Sept 12 ], there are a lot of updates from the Kurakhove direction.

Here, in a shocking turn of events, Russian forces have launched a series of high-casualty “meat wave” assaults on the town of Vodiane, near Vuhledar. These devastating attacks, with soldiers advancing over the bodies of their fallen comrades, have left military analysts questioning how long Russia can sustain such a costly and desperate strategy, before once again rolling back and nullifying their gains.

As outlined in the previous report, Russian forces have altered their approach in their renewed effort to capture Vuhledar. Instead of relying on direct frontal assaults as they did before, they are now attempting to encircle the town, launching coordinated offensives from the south and northeast.

The Russian strategy for the northern pincer hinges on crossing the T0532 highway and capturing the town of Vodiane. Once they establish fortified positions there, the plan is to advance southward toward the South Donbas coal mine. Russian commanders believe that seizing control of this key facility would significantly boost their chances of finally taking Vuhledar - a strategic objective that has remained out of reach for over two and a half years.

Recent geolocated footage has captured a series of intense and costly Russian assaults on Vodiane. In one particularly disastrous attempt, around 10 motorcycles advanced from the northern flank of the Vuhledar front.

This tactic, previously used by Russian forces in other sectors with often catastrophic outcomes, due to the lack of protection for the riders, underscores their continued reliance on high-risk strategies, despite repeated failures.

Even more disturbing footage captures the grim continuation and conclusion of this ill-fated motorcycle assault. The images reveal a Russian “meat wave” attack, with dozens of soldiers advancing under relentless mortar fire. Russian troops are seen literally marching over the bodies of their fallen comrades, showcasing the brutal nature of these saturation tactics.

Ukrainian soldiers report that the relentless, infantry-heavy assaults enable small groups of surviving Russian troops to make incremental advances, as the sheer volume of attackers makes it difficult to eliminate them all. Survivors from the initial waves regroup in tree lines and small dugouts. Once enough have gathered, they push forward again.

While Ukrainian forces focus on neutralizing the nearest threats, Russian reinforcements continue to bolster the lines behind. This tactic allows Russian forces to inch closer to the village, advancing tree line by tree line, and eventually infiltrating buildings and hiding in basements until another critical mass is formed. This slow, high-casualty strategy explains Russia’s gradual, albeit costly, advance toward Vodiane.

These two pieces of evidence explain how, according to recent reports and visual confirmation, Russian forces have managed to penetrate the northern part of Vodiane through relentless saturation attacks. Geolocated images now confirm that Russian troops have established positions in the northern residential area. In the background of these images, the auxiliary buildings of the South Donbas coal mine and its waste heap are clearly visible, further validating their foothold in this critical zone.

Following the capture of Vodiane, the next strategic objective for Russian forces is the South Donbas coal mine. If we look at the topographic map, we can see that Vodiane lies in the lowlands, whereas the coal mine is located on the high ground. This elevation, combined with the presence of tall, robust buildings offering concealed defensive positions, provides a significant advantage for Ukrainian defenders - an advantage they lacked in Vodiane.

The contrast in terrain and defensive infrastructure suggests that Russian forces will likely face far greater resistance and must endure the loss of many more soldiers, before they can hope to seize the coal mine. The elevated and fortified nature of the area makes it a much more formidable challenge compared to the lowlands recently overtaken.

This is why, despite their localized gains, military analysts argue that Russian forces are unlikely to maintain the initiative across eastern Ukraine indefinitely.

The mounting pressure from intensified offensives in Donetsk Oblast, combined with the ongoing strain from Ukraine’s incursions into Kursk Oblast, is expected to force Russian offensive operations to culminate sooner than their military command intends. These overlapping challenges could significantly weaken Russia’s ability to sustain its current momentum.

Overall, while Russian forces have managed to advance on Vodiane through relentless saturation attacks, sacrificing a staggering number of personnel, the sustainability of these tactics is increasingly in doubt. Signs of operational exhaustion are already evident in the Pokrovsk direction, where Russian troops have depleted their reserves at an unsustainable rate, and have failed to make any territorial gains over the past week.

This stagnation in Pokrovsk highlights the limitations of Russia’s current offensive strategy and suggests that similar culmination points could emerge in other sectors, including Vuhledar. The heavily fortified nature of their next objectives, combined with difficult terrain, indicates that sustaining this momentum will come at an even higher cost in manpower and resources.

With pressure building on multiple fronts, Russian command may find their offensive capabilities stretched to the breaking point sooner than expected. This potential weakening could open the door for Ukrainian counterattacks in the weeks ahead.


6,240 posted on 09/12/2024 5:18:05 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6238 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,201-6,2206,221-6,2406,241-6,260 ... 19,241-19,257 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson