Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,101-6,1206,121-6,1406,141-6,160 ... 8,361 next last
To: AdmSmith

Could you just add me to your ping list?


6,121 posted on 09/09/2024 2:34:22 PM PDT by Mr. Lucky
[ Post Reply | Private Reply | To 6113 | View Replies]

To: PIF; All

Rand Paul. What can I say?

“US House Passes Bill to Blacklist Some China Biotech Firms”

/////////

“Rand Paul, a libertarian-minded Kentucky Republican who was the sole vote against a Senate version of the biosecurity bill in committee, told Bloomberg in July he’d block quick passage of the legislation.

“I think it’s a mistake to let hysteria over China stop international trade,” he said, warning that “trade isolationism” could lead to war.”

https://www.bloomberg.com/news/articles/2024-09-09/after-tiktok-china-biotech-next-to-face-wrath-of-us-congress?srnd=homepage-americas


6,122 posted on 09/09/2024 6:02:51 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6121 | View Replies]

To: SpeedyInTexas; All

Domodedovo airport in Moscow explosion and fire.


6,123 posted on 09/09/2024 6:12:17 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 6109 | View Replies]

To: marcusmaximus; All

“BREAKING:

For the first time, Ukrainian drones are striking Domodedovo International Airport in Moscow.

It’s the second-largest airport in Moscow after Sheremetyevo Airport.”

https://x.com/visegrad24/status/1833315260490539515


6,124 posted on 09/09/2024 6:31:22 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6123 | View Replies]

To: SpeedyInTexas

“ the slow-motion disappearance of Russia’s last piggy bank, the liquid part of the so-called National Wealth Fund.

The chart asks us to believe that Russia stopped spending their gold reserves and Yuan, since January. More likely, they just stopped reporting.

I’d guess that the reduction in China’s gold purchases over the last four months might be due to unreported Russian gold meeting their domestic demand.


6,125 posted on 09/09/2024 10:38:17 PM PDT by BeauBo
[ Post Reply | Private Reply | To 6082 | View Replies]

To: SpeedyInTexas

Russian Offensive Campaign Assessment, September 9, 2024

Ukrainian officials continue to warn that Russian forces are increasingly using chemical weapons in Ukraine. Ukraine’s Support Forces Command reported on September 9 that Russian forces used ammunition equipped with dangerous chemicals and chemical agents 447 times in August 2024 and 4,035 times between February 15, 2023 and August 24, 2024.[23] The Ukrainian Support Forces Command stated that Russian forces are using K-51 and RG-VO gas grenades to deliver munitions containing banned chemical agents and are also using unidentified chemical compounds. Ukrainian officials, and a Russian military unit, have previously reported on increasingly common instances of Russian forces using chemical agents in combat that are banned by the Chemical Weapons Convention (CWC), to which Russia is a signatory.[24]

more + maps
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-9-2024


6,126 posted on 09/10/2024 12:29:46 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6095 | View Replies]

To: adorno; alexander_busek; AmericanInTokyo; Apparatchik; ArtDodger; AZJeep; baclava; BeauBo; ...
Is this an indication of Russian ...?

Russian blogger:

On the death of Russia's worst enemy and the war with NATO

Few of us noticed this news, and in vain. It is very important. David Knowles died the day before. One of the most malicious and dangerous pro-Ukrainian propagandists in the West, Russia's worst enemy. We personally suffered with him. It is impossible to tell yet, but believe me. He died in Gibraltar. At the age of 32. They say, from cardiac arrest. Let's agree with this version. Let's agree with pride for several of our guys who know how to work effectively. Including abroad, where it is difficult to achieve results now. We are proud, guys!

It seems like we should be happy. But we have sad thoughts. The most important thing is - why, with such a heroic personnel, are we in such a bad situation with the leadership of a number of special services? And many successes are drowning in failures? Why do we not have systemic work abroad? And we are not the only ones saying this. Just look at how they tried to disrupt the allocation of assets stolen from Russia to the Kiev regime. Or American aid to Ukraine. Nothing was disrupted.

“There is bad news. NATO is very close to allowing the Kiev regime to strike any territory of Russia with its weapons. They simply stopped being afraid of us, that's all. Kursk Oblast was the last straw, but far from the first. What are we supposed to do now, fight NATO directly?” a source in one of the intelligence services shared his sad thoughts. “Nobody is going to fight NATO now. Then, I hope, we will gather our strength. But now it will be a disaster. Right now, I won't hide it, we don't have enough strength. And NATO, by the way, is still afraid of us. And this fact is encouraging. Although they are afraid less and less,” one of the generals confided in a conversation with us.

Why did we write all this? We hope that Vladimir Vladimirovich will read the post. And he will make personnel changes, after which they will again be afraid of us – for real. Without systematic work, this is impossible. We are sure that everyone who needs to will understand what this post is about. And we hope for changes.

https://www.telegraph.co.uk/news/2024/09/09/david-knowles-journalist-telegraph-dies-ukraine-war-podcast/

6,127 posted on 09/10/2024 4:09:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6111 | View Replies]

The meat grinder in operation


6,128 posted on 09/10/2024 4:14:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6096 | View Replies]

To: AdmSmith

Victoria Nuland, who grins like the Cheshire Cat while explaining her gov’t sabotaged a peace deal and ensured a fight to the last Ukrainian so that U.S. weapons makers could cash in, is proof that evil exists https://t.co/KXzRCB7lXB— Anya Parampil (@anyaparampil) September 9, 2024


6,129 posted on 09/10/2024 4:32:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6128 | View Replies]

To: BeauBo

Articles of Interest:

Sweden’s JAS-39 Gripen Fighters Still On The Table For Ukraine
There are no immediate plans to transfer the jets to Ukraine, but a new aid package gives Sweden that option.
https://www.twz.com/air/sweden-gripen-jas-39-fighters-still-on-the-table-for-ukraine


Russian Shahed Kamikaze Drone Crashes In Latvia
Russian drones came down in two NATO countries, while mysterious drone incursions continue to fuel fears of espionage.
https://www.twz.com/air/russian-shahed-kamikaze-drone-crashes-in-latvia


6,130 posted on 09/10/2024 4:42:06 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6125 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Unleash Dragon-Drones & Incinerate Russians on The Spot! ]


Today [ Sept 10 ], there are a lot of updates from the Kharkiv direction.

Here, in a pivotal moment during Ukraine’s defense of the tactically important settlement of Lyptsi, Ukrainian forces launched a decisive counterattack that reversed recent Russian gains and reasserted control over critical high ground. As part of this operation, Ukrainian soldiers unveiled a game-changing new weapon: flamethrower-equipped drones, adding a new dimension to their battlefield tactics.

Although small, the settlement of Lyptsi plays a crucial role as a local base for Ukrainian forces, serving as both a supply hub and a gathering point for troops. It also functions as a launching pad for counterattacks to the north. This tactical importance is why Russian forces are determined to capture Lyptsi by advancing from the surrounding hills, aiming to exploit the high-ground advantage. If we look at the topographic map, we can see that these hills extend directly to the edge of the residential area.

If the Russians manage to reach this far, even without sufficient personnel for an immediate assault, they could establish fire control over the lowlands. This would likely force the Ukrainians to partially withdraw from the settlement, as defending it would become increasingly difficult under the threat of Russian dominance from the elevated positions.

As Russian forces began amassing a critical number of troops in preparation for an imminent assault, the Ukrainian command responded swiftly, organizing an urgent counterattack to reclaim the high ground and disrupt the enemy’s plans. The task was assigned to the 13th Brigade of the Ukrainian National Guard, Khartiia, composed primarily of soldiers from the Kharkiv region.

Shortly after, the brigade released a video detailing the operation, offering a rare glimpse into the meticulous planning behind such actions. 48 hours before the assault, officers are seen strategizing around an accurate scale model of the battlefield, carefully analyzing every detail.

With 24 hours remaining, the officers brief the soldiers assigned to various assault groups, conducting detailed training with armored vehicles to rehearse each step of the bold raid. Four hours before the operation, in the dead of night, all troops are in position, methodically checking their equipment, fully prepared for the crucial mission that lies ahead.

In the early morning hours, Ukrainian armored vehicles surged forward at full speed under the cover of darkness. As the first rays of sunlight pierced through, the vehicles’ cannons erupted, hammering Russian positions and clearing the way for Ukrainian stormtroopers to land safely. A fierce close-quarters battle ensued in the trenches and dugouts, with infantry supported by drone operators who not only kept a constant watch on enemy movements, but also dropped grenades on their targets.

This high level of coordination enabled Ukrainian commanders to monitor the troops’ every move and provide precise artillery support, helping to clear Russian positions hidden in the wooded hills. The intensity of the Ukrainian assault soon became overwhelming, forcing Russian soldiers to flee, leaving behind their dead comrades.

In the aftermath, Ukrainian soldiers, visibly triumphant, were seen on camera celebrating the successful operation and collecting war trophies. This decisive action allowed the Ukrainians to reclaim nearly 3 sq.km of crucial high ground, driving the Russians back and preventing their planned assault on Lyptsi.

But this was only the beginning of the bad news for Russian soldiers, as the Ukrainians chose this moment to unveil a new and devastating innovation in drone warfare - the so-called flamethrower drones.

Soldiers from the 42nd Mechanized Brigade released a video showcasing an FPV drone equipped with thermite warheads. Thermite, a pyrotechnic mixture of metal powder and metal oxide, ignites through heat or chemical reaction, producing an intense burst of heat and extremely high temperatures in a concentrated area.

With these drones, Ukrainian operators can ignite entire dugouts and enemy hideouts, even in dense forested areas. The effectiveness and sheer destructiveness of this weapon are vividly displayed in the aftermath images of the targeted zones, revealing the devastating impact of this cutting-edge tactic.

Overall, the Ukrainian counter offensive near Lyptsi, supported by the introduction of flamethrower drones, underscores a significant evolution in modern warfare, where rapid tactical adaptation and technological innovation can shift the balance on the battlefield.

By quickly reclaiming strategically vital position,s Ukraine demonstrated not only operational superiority, but also Ain ability to disrupt Russian plants before they could materialize into larger territorial gains.

The successful recapture of the hills not only safeguarded Lyptsi, but also secured vital high ground putting Ukrainian forces back in control of the local battlefield dynamics.

Moreover, the deployment of thermite equipped drones exposes a critical vulnerability in Russian defenses, one that could lead to further disarray, if not swiftly addressed.

This development illustrates how Ukraine is leveraging new technologies to out pace its adversary, creating a precedent that could redefine the future trajectory of the conflict by prioritizing agile tech driven assaults over conventional strategies.


6,131 posted on 09/10/2024 4:57:27 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6122 | View Replies]

To: SpeedyInTexas

The nighttime Ukrainian drone strike targeted military unit 61991 and warehouses in a Moscow suburb near the town of Ramenske.

Ukrainian sources said Fateh-360 ballistic missiles, recently shipped from Iran, were stored there.


6,132 posted on 09/10/2024 5:09:48 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 6124 | View Replies]

To: marcusmaximus

short video https://x.com/Maks_NAFO_FELLA/status/1833477772355727825


6,133 posted on 09/10/2024 6:13:06 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6132 | View Replies]

To: PIF; All

Shocked one of these RuZZian Boys didn’t shoot the other one.

We can literally say, drones have RuZZians Boys running around in circles.

https://x.com/RALee85/status/1833385821732303341


6,134 posted on 09/10/2024 6:56:27 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6133 | View Replies]

To: PIF; All

Oh no. No peace negotiations. Jon Boy will be so disappointed.

“Shoigu says that there will be no negotiations with Ukraine until the Ukrainian military is “thrown out” from Russian territory.

“Until we throw them out of our territory, we, naturally, will not talk about any negotiations with them””

https://x.com/wartranslated/status/1833400202641711353


6,135 posted on 09/10/2024 7:04:19 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6134 | View Replies]

To: PIF; All

I like McCaul. He is my rep. Hope he is correct here.

“House Foreign Affairs Chairman Michael McCaul stated that U.S. Secretary of State Antony Blinken, during a recent conversation, indicated he would be traveling with his UK counterpart to Kyiv to inform Ukrainian officials that they will be allowed to strike Russia with ATACMS missiles, according to Capitol Hill reporter @juliegraceb”

https://x.com/NOELreports/status/1833494255546814962


6,136 posted on 09/10/2024 7:07:01 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6135 | View Replies]

To: PIF; All

“U.S. Secretary of State Antony Blinken stated that President Biden may discuss with the UK on Friday the possibility of allowing Ukraine to use long-range weapons against Russia. In addition, the U.S. will announce new sanctions against Iran for supplying missiles and drones to Russia, with expectations that Russia will use these missile supplies in the coming weeks.”

https://x.com/NOELreports/status/1833483785758818792


6,137 posted on 09/10/2024 7:08:30 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6136 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 09/10/24
https://t.me/s/kremlin_secrets

The Ukrainian Armed Forces are hitting Moscow again. Here are two important insights

Last night, enemy drones again attacked Moscow and the region. In particular, the Zhukovsky airfield came under attack, one drone was shot down in Kolomna, and residential buildings in Ramenskoye near Moscow were also damaged.

There are two important points about this.

Firstly, in Kolomna, a drone was flying towards the Moscow Oil Refinery. Yes, the same oil refinery that was attacked on the night of September 1st. This confirms the dynamics of increasing attacks on oil refining facilities.

Secondly, the increasing frequency of attacks in Moscow is causing tension among the authorities in the capital.

“Sergei Semenovich (Sobyanin - Ed.) has repeatedly discussed with the Ministry of Defense the need to protect Moscow. But you can imagine the scale of our country - there are thousands of objects that need cover. And we have a huge front line that also needs to be covered with something. The latest attacks show that the enemy can reach Moscow. I think this is our new reality,” said an interlocutor surrounded by Sobyanin.

It is worth noting that they categorically refused to disclose data about damage at Zhukovsky airport to us. There is information about damage to the runway. But allegedly not only she got it.

“We are seeing an increase in the number of drones that are used for attacks. The drones themselves, admittedly, are not bad. Often resistant to electronic warfare, cheap “cardboard” ones are launched along with them to deceive our air defense,” a source in the Ministry of Defense told us.

Let us recall here that we warned about the need to prepare our citizens for more massive attacks by the Ukrainian Armed Forces. The enemy does not have long-range missiles, but, unfortunately, there are enough drones.


Eyewitnesses post footage of a drone crash in the Ramensky district of the Moscow region
https://t.me/bbbreaking/189182


6,138 posted on 09/10/2024 7:12:50 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6136 | View Replies]

To: SpeedyInTexas
Yep, good ol’ Pedo Joe, rah rah


6,139 posted on 09/10/2024 7:14:59 AM PDT by OldHarbor (strained statutory arguments, appeals to inconsistent history, reliance on out-of-circuit )
[ Post Reply | Private Reply | To 6137 | View Replies]

To: PIF; All

Its a Drone World

“Wild Hornets say they’ve despatched 400 kamikaze drone from their workshop just yesterday. You can imagine how many they produce in a year. And that’s just one workshop.”

https://x.com/wartranslated/status/1833419558067089447


6,140 posted on 09/10/2024 7:15:41 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6137 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,101-6,1206,121-6,1406,141-6,160 ... 8,361 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson