Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,001-6,0206,021-6,0406,041-6,060 ... 8,201-8,216 next last

6,021 posted on 09/06/2024 3:20:28 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 6020 | View Replies]

To: AdmSmith

Of the 11 modules, the last one is titled, “What to Expect When Attacking in a Meat Wave”.


6,022 posted on 09/06/2024 3:33:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6016 | View Replies]

To: AdmSmith

As
I have often asked what does being a Nazi or neo nazi mean these days. To me it’s a buzz word like racist or bigot.

What is more important is to ask what counties are exhibiting behaviors similar to behaviors nazi germany had.

Nazi germany was a political party which was fascist . A large internal security apparatus to control the population, restricted speech. Considered its population superior to all others. Invaded other countries for its Lebensraum….

If you apply that metric then Russia may not take the title as nazis, but they exhibit the actions of Nazi germany


6,023 posted on 09/06/2024 4:36:30 AM PDT by blitz128
[ Post Reply | Private Reply | To 6016 | View Replies]

To: AdmSmith

Guess these folks believe the war will last another 18-20 years.

Reminds me of the best line best time to plant a walnut tree , 20 years ago. Second best today.

There is a demographic time bomb for most countries, Russia is no different.


6,024 posted on 09/06/2024 4:40:05 AM PDT by blitz128
[ Post Reply | Private Reply | To 6015 | View Replies]

To: PIF

I may be overly optimistic but I believe the operations in pokrovsk for the Russians is a “win” at any cost scenario.

Will they take pokrovsk? I doubt it. The distance they have yet to make before reaching the city is enormous relative to gains that have made and loses sustained. Each kilometer they gain is littered in dead bodies and burned out equipment and their supply lines get longer.

They may be trying to make Kursk the new norm, but Russians don’t take defeat well especially on their land.


6,025 posted on 09/06/2024 4:53:52 AM PDT by blitz128
[ Post Reply | Private Reply | To 6008 | View Replies]

To: PIF; blitz128

The Russians are planning for perpetual war, but their resources are finite.


6,026 posted on 09/06/2024 5:03:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6022 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Footage: Strongest Ukrainian Bastion vs. Russian Meat Wave Attacks ]


Today [ Sept 6 ], there are a lot of updates from the Kurakhove direction.

Here, in a daring maneuver, Russian forces have launched a bold assault on the Pivdenno-Donbaska coal mine, a crucial stronghold just 2 kilometers from Vuhledar. As the battle unfolds, the fate of this industrial complex hangs in the balance, with both sides acutely aware that its capture could dramatically alter the entire Vuhledar front.

Vuhledar remains one of the most symbolically significant strongholds in Ukrainian hands in this direction.

Two key factors underscore its importance.

Firstly, Vuhledar is situated at a dominant height, and its residential areas, featuring high-rise buildings or citadels, have allowed Ukrainian forces to establish formidable bastions, dominating a vast area of the Russian advance.

Secondly, since the war’s outset, Vuhledar has been a crucial supply center due to its proximity to 2 major roads: the T0509 from Velyka Novosilka and the T5024 from Vuhledar to Kostyantynivka.

Over the past two years, Russian forces have repeatedly attempted to capture Vuhledar using frontal mechanized assaults from the south, suffering catastrophic losses. In recent days, Russian forces have resumed assault operations on Vuhledar and the nearby locality of Vodyane.

Extensive artillery preparation has been done over the whole area, with satellite data confirming the extraordinary intensity of Russian artillery discharges.

Crucially, the Russian strategy has shifted from frontal assault efforts to an encirclement attempt from the south and northeast. To the northeast, Russian forces managed to move the front line to the T0532 road itself and have also crossed and taken positions beyond it at limited points.

This effectively renders the road mostly unusable as a logistical supply route for Ukraine. At the same time, an attack from the south aimed at Prechystivka has also put under severe pressure the T0509 road as a supply road to Ukrainian forces.

Fortunately, Ukrainian forces still can rely on the road descending from Bohoyavlenka as the primary logistical route.

Moreover, due to dry weather conditions, Ukrainians could rely on uncountable dirty tracks to complement the main route. With these alternatives, the Ukrainians are still far from facing personnel and equipment supply problems to Vuhledar.

A prominent Russian military analyst has recently claimed that Russian forces have crossed the road southeast of Vodyane and are now trying to advance toward this settlement with a relatively broad front. Some Russian sources suggest that initial Russian forces have even managed to enter the northern area of Vodiane, albeit in a very limited manner.

Of particular concern, Russian forces have also advanced towards the Pivdenno-Donbaska mine number one, located just 2.5 kilometers northwest of Vuhledar. This complex, one of Ukraine’s most important coal mines, opened in 1973 and has galleries almost half a kilometer deep. Its industrial facilities have served as a support bastion for Vuhledar in countless Russian frontal assaults over the past 2 years.

Geolocated images recently published by Ukrainian sources show the landing of Russian infantry, supported by a BMP-2, which initiates the storming of an industrial site belonging to the Pivdenno-Donbaska mine. The BMP-2 vehicle was reportedly hit in the side, but managed to withdraw.

While this isolated landing attempt appears to be a mere exploratory probe than part of a broader effort, the diligent Ukrainian response, based mainly on FPV drones, demonstrates that the defense of Vuhedlar and its surroundings is still based on the same principles that have made it an impassable bastion for more than two years, that is, significant reconnaissance efforts for an early warning, the efficient combination of minefields, ATGMs, artillery force and particularly FPV drones, which together have managed to successfully stop all Russian mechanized attacks.

The potential loss of the Pivdenno-Donbaska mine could be critical for several reasons.

Firstly, the mine area not only has robust high industrial buildings, but also includes a notable waste heap.

If we look at the topographic map, we can observe that the terikon conforms an artificial elevated area, from which Russian forces could monitor and control Ukrainian movements, and potentially threaten Ukraine’s defense efforts.

Secondly the industrial zone of the mine being just 2.5 km away, could provide Russian forces with a very convenient location for accumulating forces and mechanized equipment, enabling a direct offensive against Vadar itself.

However, for this very same reason Ukrainian forces undoubtedly rely on the mine’s vast storage capacity to accumulate ammunition and personal provisions.

So the seizure of the mine and its industrial area will certainly present huge challenges to the Russian infantry trying to gain control of it.

Holding the mine and Vuhedlar is critical for Ukrainian forces because if Russians finally capture Vuhedlar, they will open operational space behind it given the absence of significant populations and fortification lines in that area.

The next potential bastion of the Vuhedlar that could play a similar role would be local like Novoukrainka which is also located in the hill.

Overall, the situation around Vuhedlar remains tense, but far from critical.

Russian forces are making incremental progress in their encirclement attempts, potentially threatening this key Ukrainian stronghold in the coming weeks.

However, Ukrainian forces maintain not only the full logistic supply capacity to the settlement, but also every defense tactic element in order to slow down and contain these renovated Russian efforts until depletion.

The coming days will be crucial in determining whether Ukrainian forces can maintain their hold on Vuhedlar and the surrounding area, or if Russian forces will achieve a significant breakthrough in this sector.


6,027 posted on 09/06/2024 5:09:47 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

Try have found themselves in an infinite war of their own making, and a war that was once a existential threat to Ukraine is now one for Putin

Like Hitler he has to fight this to the last drop of Russian blood . A loss means he is taking a trip to the 13th floor to check out the view😎


6,028 posted on 09/06/2024 5:58:16 AM PDT by blitz128
[ Post Reply | Private Reply | To 6026 | View Replies]

To: PIF; All
Back in the USA. You don’t know how lucky you are boys.




6,029 posted on 09/06/2024 10:48:29 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6028 | View Replies]

To: PIF; All

Russia - 17688, of which: destroyed: 12955, damaged: 779, abandoned: 1000, captured: 2954

Tanks (3356, of which destroyed: 2304, damaged: 156, abandoned: 366, captured: 530)


6,030 posted on 09/06/2024 10:49:21 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6029 | View Replies]

To: PIF; All

“Iran has sent short-range ballistic missiles to Russia, a move that will give Moscow another potent military tool to use in the war against Ukraine and follows stern Western warnings not to provide those arms to Moscow, according to U.S. and European officials.”

https://x.com/RALee85/status/1832112915085754513


6,031 posted on 09/06/2024 10:50:52 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6030 | View Replies]

To: PIF; All

To the Ukrainian Front Old man.

“According to unconfirmed information from the Russian publication SHOT, Girkin will be released from the colony and sent to the “SMO zone”.

The lawyers of the former “DPR” defense minister allegedly managed to obtain the corresponding permission from all relevant departments. As a result, Girkin’s imprisonment was replaced with service in the “special operation zone”.”

https://x.com/wartranslated/status/1832013469375189256


6,032 posted on 09/06/2024 10:53:31 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6031 | View Replies]

To: PIF; All

Maybe Trump secretly wants Harris to win.

“Trump, in a very incoherent story, hinted that he would lift or at least modify sanctions on Russia and Iran.

“I want to use sanctions as little as possible.””

https://x.com/NOELreports/status/1832097687375589607


6,033 posted on 09/06/2024 10:58:14 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6032 | View Replies]

To: PIF; All
New US aid package.




6,034 posted on 09/06/2024 11:00:14 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6033 | View Replies]

To: PIF; All

“Germany has pledged to deliver twelve more Panzerhaubitze 2000 self-propelled howitzers to Ukraine, Defense Minister Boris Pistorius announced this at a meeting in Ramstein. Six of these advanced artillery systems will be delivered this year, with the remaining six coming next year. Additionally, Germany along with Denmark and The Netherlands, aims to quickly transfer 77 Leopard 1A5 battle tanks to Ukraine.”

https://x.com/NOELreports/status/1832010334535549292


6,035 posted on 09/06/2024 11:01:19 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6034 | View Replies]

To: PIF; All

THERMITED

“Russian soldiers complaining that after a Ukrainian FPV drone strike with thermite, everything at their position was destroyed, including computers, laptops, and a communications hub.”

https://x.com/NOELreports/status/1832003201605734430


6,036 posted on 09/06/2024 11:02:22 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6035 | View Replies]

To: PIF; All

Also, time for Congress to fund next fiscal year’s aid package to Ukraine.

“The Biden administration is in urgent talks with Congress to secure the use of $6 billion in military aid for Ukraine before the Sept. 30 deadline, as much of the $7.8 billion allocated in April remains unused. The administration hopes to extend the Presidential Drawdown Authority (PDA), the key mechanism for providing defense support, by attaching it to a short-term emergency spending bill to prevent the funds from expiring with the fiscal year.”

https://x.com/NOELreports/status/1831942776247775628


6,037 posted on 09/06/2024 11:04:40 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6036 | View Replies]

To: PIF; All

“Russians in the frontline settlements of the Kursk region are afraid to leave their homes as they may be looted by Russian soldiers - BBC Russian Service.

When asked why the military does not fight looting, one of the locals replied: “Good question. Are you not aware that it is soldiers who are doing the looting?”, BBC wrote.

People complain that when they try to report looting to the police, they are told that it is impossible to prove that it was the military, and not themselves or their neighbors, who broke into their homes. Many people also fear that complaints against the military are fraught with accusations of discrediting the army.

Not surprisingly, local authorities do not comment on complaints from residents of the Kursk region, only saying that there are “no looters in the region.””

https://x.com/Gerashchenko_en/status/1832094773361906118


6,038 posted on 09/06/2024 11:06:16 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6037 | View Replies]

To: PIF; All

Ukrainian military aid: Best use of US taxpayers money, instead of more income redistribution programs.

“”There are a lot of wounded soldiers here, there is not enough space. They put us in a morgue.”

Russian employee of the so-called “hospital” complains that all medical facilities are overcrowded, so the Russian soldiers were put in an abandoned morgue. She also said that they have problems with medicine and food, “but, luckily a colleague has apples growing on her plot of land, which she brings to the wounded.””

https://x.com/Gerashchenko_en/status/1832056693074633185


6,039 posted on 09/06/2024 11:08:31 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6038 | View Replies]

To: PIF; All

This will require US strikes against RuZZian targets.

“CNN Exclusive: US has detected increased Russian military activity around key undersea cables and believes Russia may now be more likely to carry out potential sabotage aimed at disabling a critical communications infrastructure, two US officials tell me.”

https://x.com/jimsciutto/status/1832028660699697199


6,040 posted on 09/06/2024 11:11:45 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6039 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,001-6,0206,021-6,0406,041-6,060 ... 8,201-8,216 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson