Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,881-5,9005,901-5,9205,921-5,940 ... 19,281-19,290 next last
To: AdmSmith; FtrPilot; SpeedyInTexas; BeauBo; All

Speculation that he was fired because 2 previous Ukrainian fighter crashes were also friendly fire. So this would have been the third.


5,901 posted on 08/30/2024 10:22:41 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 5900 | View Replies]

To: marcusmaximus; ETCM

ETCM… any information?


5,902 posted on 08/30/2024 10:30:28 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5901 | View Replies]

To: AdmSmith; FtrPilot; SpeedyInTexas; BeauBo; PIF; All

Additionally, Russians still claiming additional Ukrainian fighters jets hit by missiles or drones on Monday after returning to their bases in Kolomyia and/or Starokostiantyniv.


5,903 posted on 08/30/2024 10:36:44 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 5901 | View Replies]

To: marcusmaximus

hardspurned posted a story about 3 more shot down F-16s.


5,904 posted on 08/30/2024 12:36:19 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5903 | View Replies]

To: PIF

I would think the Russians would have posted drone video of the strikes on the bases by now so I’m somewhat skeptical about the other two on Monday.

But I think the 2 previous friendly fire incidents (non F16) and coverups are probably true.


5,905 posted on 08/30/2024 12:49:28 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 5904 | View Replies]

Russian Offensive Campaign Assessment, August 30, 2024

Russian state-owned polling agencies are recognizing limited upticks in Russian domestic discontent towards Russian President Vladimir Putin and Russian authorities amid the Ukrainian incursion into Kursk Oblast. The Public Opinion Foundation, a Russian state-owned polling institution, published a poll on August 30 that it conducted on August 25 showing that 28 percent of respondents expressed outrage or dissatisfaction with the actions of Russian authorities over the past month.[13] This is up from 25 percent and 18 percent in polls that the Public Opinion Foundation conducted on August 11 and July 28, respectively.[14] Respondents to the Public Opinion Foundation poll have not expressed such high dissatisfaction since polling conducted in November 2022, following the first month of the deeply unpopular partial mobilization in Russia.[15] The Russian state-owned Public Opinion Research Center (VCIOM) noted that Putin's approval rating fell by 3.5 percent to 73.6 percent between August 12 and 18 — a record fall in Putin's approval rating, even among Kremlin pollsters, since the start of the full-scale invasion in February 2022.[16]

VCIOM released its latest polling on Putin's approval rating on August 30, showing an additional 1.2 percent decline to 72.4 percent between August 19 and 25.[17] These polls from Russian state-owned polling agencies do not suggest particularly pronounced discontent nor are they reliable reflections of the actual sentiments in Russian society. The polls do suggest, however, that the Kremlin assesses that it must recognize that societal discontent has risen since the start of Ukraine's incursion into Kursk Oblast. The Kremlin likely hopes that limited acknowledgment of societal discontent will guard against accusations that it is ignoring Russian society's concern about the Ukrainian incursion. The Kremlin appears to have launched an intricate messaging campaign aimed at justifying to its domestic audience why Russia is prioritizing the maintenance of offensive operations in eastern Ukraine over immediately expelling Ukrainian forces from Kursk Oblast, and limited acknowledgments of discontent may be a part of this campaign.[18]

more + maps
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-august-30-2024

5,906 posted on 08/31/2024 1:38:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5887 | View Replies]

1 360!


5,907 posted on 08/31/2024 1:49:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5891 | View Replies]

To: marcusmaximus

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Ukrainians Tighten Noose. Russians Run Away Leaving Intact Tanks Behind ]


Today [ Aug 31 ], there are a lot of updates from the Kursk direction.

Here, the Ukrainians launched a powerful attack at the northern flank of Korenevo, effectively encircling a large concentration of Russian fighters. Simultaneously they are advancing on the southern flank, setting the stage for an even larger encirclement of Russians in Korenevo.

As previously reported, Ukrainian forces entered Korenevo and consolidated their positions on the eastern outskirts, after the Russians redeployed their main force away from the town. However, Russian troops in the area quickly organized a defense along the Krepna River, which runs through Korenevo.

To avoid brutal urban combat, the Ukrainian command shifted its main focus to the northern and southern flanks, assembling powerful assault formations to advance from these directions.

The most significant Ukrainian tactical success occurred on the northern flank of the town. It was initially believed that Russian forces in this area maintained a solid defensive line along the Krepna River, except for the village of Zhuravli. However, Ukrainian forces launched powerful assaults to bypass this line, aiming to break through the Russian defenses and reach the railway embankment to the north, setting the stage for prolonged clashes.

The Russian forces defending the line at Kremyanoye and Durovka suffered from poor coordination, due to ineffective communication, and the inability to adapt to Ukrainian advances. With a limited number of troops in the region, the Russian command struggled to deploy and cover all gaps in their defenses against the Ukrainian push.

Additionally, the quality of the Russian forces was compromised; while experienced marines were reserved for ambushing Ukrainian raids from the rear, the primary defensive positions were manned by conscripts.

This situation has allowed the Ukrainian offensive groups from the 82nd Air Assault Brigade to effectively use their Stryker mechanized units to breach the scattered Russian defense lines. As a result, the Ukrainian forces have reached the railway embankment northeast of Korenevo, successfully bypassing the Russian defenses.

The Russian command’s failure to deploy sufficient troops along the defensive line allowed Ukrainian forces to exploit these gaps and launch attacks from behind. This situation left the Russian forces with all escape routes under the control of Ukrainian assault groups.

An updated map provided by Ukrainian Commander-in-Chief Syrsky, indicated that the Russians still control the towns of Kremyanoye and Durovka. This means that Ukrainian forces now hold positions all around them, effectively placing the Russian troops in a state of complete encirclement.

To leverage their newly gained territories for further assaults north of the town, Ukrainian forces will focus on eliminating the pocket of encircled Russian troops. While the encirclement almost guarantees the elimination of these forces, it will extend the clashes, as the Russians have no option for withdrawal.

Consequently, the encircled Russian troops are likely to surrender, once they exhaust their ammunition and are no longer able to continue the fight.

The fall of the Durovka-Kremyanoye pocket would allow Ukrainian forces to advance on the northern part of Korenevo. Capturing this northern section would sever the Korenevo-Rylsk highway, completing the encirclement of the Russian garrison in the town and paving the way for its eventual takeover.

Simultaneously, Ukrainian forces have continued their advance south of Korenevo. Elements of the Ukrainian 36th Marine Brigade are working to expand the southern flank to secure it for a main assault on Korenevo from the south. During these operations, the Ukrainian marines have established control over the village of Vishnevka and captured half of Komarovka.

The goal of the Ukrainian command in this area is to advance and secure positions along the Snagost River to simplify flank defenses. By achieving this, they would reduce the number of troops needed to guard the flanks, allowing a greater concentration of forces to intensify attacks south of Korenevo and bolster the main offensive.

The main factor contributing to the success of the Ukrainian Marines in the area is their opposition to the Russian 155th Marine Brigade. This unit is notorious for one of the largest Russian failures during the Battle of Vuhledar, suffering such severe losses that it now primarily consists of newly mobilized personnel. Although equipped with modern Russian equipment such as T-90M tanks and BMP3 armored vehicles, the brigade lacks the training and expertise to effectively counter the experienced Ukrainian Marines.

As a result of the engagements between Russian and Ukrainian Marines Ukrainian forces succeeded in capturing a state-of-the-art T-90M tank; this model is rare within the Russian army making its capture particularly significant.

Overall, the Ukrainians managed to compromise the flanks of Korenevo and encircle the main Russian forces at the northern flank of the town, while also pushing the Russians to the south. The ongoing operations on the flanks will allow Ukrainian forces to capture a significant number of encircled Russian troops, while continuing efforts to encircle the main force within the town itself.

The fall of Korenevo will pave the way for the next phase of the broader Ukrainian offensive in the Kursk region by opening up critical operational space.


5,908 posted on 08/31/2024 4:04:42 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5905 | View Replies]

To: PIF
Putin will visit Mongolia next week. There he may be arrested on a warrant from the International Criminal Court.

In December 2023, a Mongolian judge became an ICC judge for the first time, Charter 97 says. President of Mongolia boasted at the time that it was “a sign of the country's growing and strengthening reputation in the international arena and the confidence of international organizations in Mongolia.”

◾️ This will be the first visit by a Russian dictator to a country that has ratified the Rome Statute.

If Putin is going there, it means he has received guarantees that he will not be arrested. One of the purposes of the visit will be to show the world that Putin is above the system of international law.

A precedent will be set when a country that is a signatory to the Rome Statute of the ICC does not implement an arrest warrant that is issued by the ICC. This is an example to other countries - you can act like Mongolia.

◾️ Another purpose of the visit is to participate in celebrations marking the 85th anniversary of the joint victory of Soviet and Mongolian troops over Japanese forces on the Khalkhin-Gol River. Putin wants to show off to China and demonstrate to Japan that Russia can cause a lot of problems.

◾️ For Russia, Mongolia is an important country in terms of natural resources. Mongolia can help Russia with bypassing sanctions and with trade with China.

https://x.com/Gerashchenko_en/status/1829434343090979005

Imagine if Putin is arrested in Mongolia.

That would stop the war. Mongolia would be the country that would bring peace and forever go down in history as the great country that stopped the bloodiest dictator and murderer in the history of humankind.

Sometimes in history, things happen that you never expect. Come on, Mongolia! You'll get a lot if you show courage. It would be the greatest history lesson. And not just for Putin.

https://x.com/Gerashchenko_en/status/1829837790936174899

5,909 posted on 08/31/2024 8:30:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5908 | View Replies]

To: FtrPilot

Just stepped off a cruise ship and haven’t really been keeping up for the past 8 days.


5,910 posted on 08/31/2024 8:33:28 AM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 5902 | View Replies]

A spokesperson for the International Criminal Court (ICC), Fadi el-Abdallah, told the BBC on Aug. 30 that Mongolia, as an ICC member state, is obligated to comply with the arrest warrant for Russian President Vladimir Putin during his upcoming visit.

The International Criminal Court (ICC) issued an arrest warrant for Putin in March 2023 for the forcible transfer of children from Russian-occupied areas of Ukraine.

Putin's visit to Mongolia on Sep. 3 would mark his first trip to an ICC member country that has ratified the Rome Statut, which obligates signatories to arrest him if he enters their territory.

“In case of non-cooperation, ICC judges may make a finding to that effect and inform the Assembly of States Parties of it. It is then for the Assembly to take any measure it deems appropriate,” the spokesperson said.

https://kyivindependent.com/icc-emphasizes-mongolias-obligations-as-member-state-in-light-of-putins-upcoming-trip/

However, a double might be OK.

https://en.wikipedia.org/wiki/Alleged_doubles_of_Vladimir_Putin

5,911 posted on 08/31/2024 9:24:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5909 | View Replies]

To: AdmSmith

the bloodiest dictator and murderer in the history of humankind.

-
The author apparently is lacking in modern history; Stalin, Mao, Hirohito, Hitler tops him, not to mention Genghis Khan


5,912 posted on 08/31/2024 9:27:48 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5909 | View Replies]

To: PIF

True.


5,913 posted on 08/31/2024 10:28:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5912 | View Replies]

To: FtrPilot

I did see the initial reports of the loss on x, and my first thought was friendly fire. The AF general being fired would support that.

Holland America has FR blocked. If I ever take another cruise I’ll be sure to set up a vpn ahead of time.


5,914 posted on 08/31/2024 12:06:07 PM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 5902 | View Replies]

To: ETCM

Welcome back, hope you had a good time cruising.


5,915 posted on 08/31/2024 12:40:51 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5914 | View Replies]

Russian Offensive Campaign Assessment, August 31, 2024

The Kremlin continues efforts to define Russia's traditional and cultural values as part of ongoing efforts to codify a Russian state ideology. Russian President Vladimir Putin signed a decree on August 26 tasking the Russian Presidential Administration's recently formed Directorate for State Humanitarian Policy to oversee the strengthening of Russia's “spiritual and moral foundations,” preservation of Russia's “traditional values,” and implementation of state historical education policies.[29] The Kremlin formed the directorate in June 2024, and the directorate will also oversee Putin's interactions with unspecified “specialized organizations” and Putin's Council for Culture and Art and advise Putin on issues related to monitoring and implementing policy in correlation with Russia's values.[30] A source within the Russian Presidential Administration told Kremlin newswire TASS on August 31 that Russian propagandist Vladimir Medinsky will oversee the recently formed directorate.[31] The Kremlin has recently intensified efforts to codify a state ideology based on vague “traditional values” while bypassing the Russian Constitution, which notably forbids Russia from establishing a state ideology and requires the Russian state to recognize ideological diversity.[32]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-august-31-2024

5,916 posted on 09/01/2024 12:49:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5906 | View Replies]

To: PIF; BeauBo; gleeaikin
Russian blogger

Do They Want to Kill Dugin? It's All About the Mobilization of Millions of Russians

Aleksandr Dugin personally informed our channel that they want to kill him. According to him, this is what the opponents of the large-scale mobilization advocated by the philosopher want to do.

“The bad news is that it is not the representatives of the Kiev regime who want to kill me now. They too, but the main danger is internal enemies. The hangers-on of the West, the opponents of a real war for our Victory and the true God in whom Russia believes, the opponents of our president,” Aleksandr Gelyevich claims.

Dugin received information about the preparation of several assassination attempts on him from “close friends from the security forces.” “It's no secret that I suggested to Vladimir Vladimirovich to mobilize from 1.5 to 2 million people (See https://freerepublic.com/perl/post?id=4219673,5645 ). After that, the enemies wanted to kill me,” the philosopher claims.

He also assured that he “is ready to be sacrificed for Russia. The main thing is that we win, and the president listens to me. On the issue of mobilization and not only.” It should be noted that sources in the security agencies have not yet confirmed, but have not denied the information about the preparation of assassination attempts on Dugin. They promise to check it.

https://t.me/kremlin_secrets/4594

5,917 posted on 09/01/2024 12:55:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5785 | View Replies]

To: AdmSmith
1 350!


5,918 posted on 09/01/2024 1:26:58 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5907 | View Replies]

To: PIF

Remember when 100 long range drones in a night was considered a big wave?

Kyiv Independent reports about last night (1 September):

“Russia claims 158 drones downed in mass attack targeting refinery, power plants in Moscow, other regions”

“drones reportedly targeted several Russian regions overnight on Sept. 1, including Moscow, Tver, Voronezh, Tula, Kaluga, Bryansk, Belgorod, Lipetsk, and Kursk, according to local officials.”


5,919 posted on 09/01/2024 1:37:37 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5908 | View Replies]

To: BeauBo

Ukraine Pushing Slowly West In Russia Towards Key Kursk City
The town of Glushkovo is the last bastion for an estimated 3,000 Russian troops trapped south of the Seim River in Kursk.
https://www.twz.com/news-features/ukraine-pushing-slowly-west-in-russia-towards-key-kursk-city


Zelensky Fires Air Force Commander As Claims Swirl Around Fatal F-16 Loss
Ukrainian Air Force Lt. Gen. Mykola Oleschuk was replaced after the destruction of one of Ukraine’s prized F-16s that also killed a well-known pilot.
https://www.twz.com/air/zelensky-fires-air-force-commander-as-claims-swirl-around-fatal-f-16-loss


Fall Of Key Ukrainian City To Russia Could Be An “Operational Catastrophe”
Russian forces are only about eight miles away from Pokrovsk which is a key logistics hub for Ukraine.
https://www.twz.com/news-features/fall-of-key-donetsk-city-could-be-an-operational-catastrophe-for-ukraine


The Future Of The AC-130 Gunship: Evolve Or Die
The AC-130 is at a crossroads as the focus shifts away from counter-insurgency and counter-terror operations in permissive airspace to peer-state conflicts, especially one in a hotly-contested Pacific.
https://www.twz.com/air/evolve-or-die-the-future-of-the-ac-130-gunship


5,920 posted on 09/01/2024 5:34:04 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5919 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,881-5,9005,901-5,9205,921-5,940 ... 19,281-19,290 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson