Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: agitprop; attackoneurope; bidenswar; bobomaximus; dailydeathfap; dailypropaganda; deathcult; dualcitizenssuck; escalation; fishiemaximus; ghoulishdelight; gleefulnosegold; globohomo; hopium; nato; oyveygoyim; phdft; propagandareturns; put; putin; russia; siloviki; snufffilmsonfr; snufffilmtx; snuffyfromtexas; spammyintexas; speedomaximus; stankazztexicunt; stenrynning; talkingtomypif; ukraine; unhealthyobsession; warporn; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath
Navigation: use the links below to view more comments.
first previous 1-20 ... 5,401-5,4205,421-5,4405,441-5,460 ... 7,421-7,440 next last
To: ETCM; SpeedyInTexas; PIF; BeauBo; FtrPilot; AdmSmith; blitz128

I think that China is sending golf carts because the Chinese economy has hit their upper middle class so hard there is now a surplus of golf carts sitting unsold. Also cheap to manufacture and makes it look like China is trying to help.


5,421 posted on 08/18/2024 3:12:55 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5368 | View Replies]

To: AdmSmith

“ Note: I’m moving to this thread to cut down on time and double posting”

Kind of a big deal worthy of more than a tiny note

Welcome aboard


5,422 posted on 08/18/2024 3:28:55 AM PDT by blitz128
[ Post Reply | Private Reply | To 5419 | View Replies]

To: SpeedyInTexas

JASSM Stealth Cruise Missiles Now On The Table For Ukraine: Report
AGM-158 JASSM would be Ukraine’s most advanced and survivable long-range strike weapon yet.
https://www.twz.com/air/jassm-stealth-cruise-missiles-now-on-the-table-for-ukraine-report


5,423 posted on 08/18/2024 3:36:58 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5287 | View Replies]

To: SpeedyInTexas

Ah, that is why China is sending golf carts. Narrow enough to cross damaged bridges.


5,424 posted on 08/18/2024 3:37:35 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5413 | View Replies]

To: BeauBo

Ukraine Drops Key Russian Bridge In Kursk
While losing the bridge is a blow to Russia’s defense of Kursk, a key Ukrainian city in Donetsk may soon fall.
https://www.twz.com/news-features/ukraine-drops-key-russian-bridge-in-kursk


Claims Swirl Around Strike On Key Russian Logistics Hub In Kursk (Updated)
Ukrainian forces continue to slowly push north toward Lgov, which has rail lines and sits along a key highway.
https://www.twz.com/news-features/claim-swirl-around-strike-on-key-russian-logistics-hub-in-kursk


Soviet Aircraft Carrier Turned Failed Chinese Tourist Attraction Is On Fire (Updated)
The Kiev class carrier Minsk has been languishing in a man-made lagoon northwest of Shanghai for years.
https://www.twz.com/news-features/soviet-aircraft-carrier-turned-failed-chinese-tourist-attraction-is-on-fire


5,425 posted on 08/18/2024 3:41:19 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5420 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Blitz Continues: Sudza City Taken. Glushkovo City Next ]


Today [ Aug 18 ], there are a lot of updates from the Kursk direction.

Here, the Ukrainians managed to consolidate control of Sudzha and use it as a logistical hub for further assaults in the southern Kursk region. To make things even worse for the Russians, Ukrainians took advantage of weak Russian border defenses to open new vectors of attack along the international borders to expand the area of operations.

The minimal damage to buildings in Sudzha indicates that there was little fighting before Russian forces withdrew. The capture of Sudzha, with its intact infrastructure, provides a strategic advantage for the Ukrainians, enabling them to establish a stable logistical hub to support further operations across the Kursk region.

This intact infrastructure allows the Ukrainian forces to set up ammunition depots, field hospitals, troop rotation points, and forward operating bases within the town. As a result, the Ukrainian command can accelerate their advance and consolidate control over newly gained territories.

The urban layout of Sudzha offers Ukrainian forces significant advantages for concealing armored and motorized vehicles, allowing them to accumulate resources for future offensives and repair damaged equipment. The buildings, along with their basements, provide concealed sleeping quarters and hideouts where Ukrainian soldiers can recover and reorganize for upcoming assaults.

As an operational hub, Sudzha enables the Ukrainian command to rapidly deploy troops to the frontlines, being just ten to twenty kilometers from all points of the front. In contrast, Ukrainian forces previously relied on Yunakivka in the Sumy Oblast as a staging ground, which is located thirty to forty kilometers from the front.

The establishment of a new logistics hub in Sudzha for the second phase of operations required the Ukrainian offensive group in Kursk to briefly slow down to consolidate their forces. Anticipating this, the Ukrainian command took proactive measures to prevent the Russians from gaining the initiative.

They employed remote mining techniques to strategically place anti-infantry and anti-tank mines along potential Russian assault routes. This approach effectively thwarted Russian counterattacks, as the lack of sufficient armored vehicles in the area made such assaults too costly for the Russians to risk.

Aware that the minefields around Sudzha would slow their progress, the Ukrainians prepared additional combat-ready units to sustain their assault. They opened a new axis of attack from the village of Plekhovo toward the Russian-held town of Giri on the southern flank.

The primary objective was to advance along the road south of the Psel River, targeting Giri, which lies to the south of Belitsa. Once this objective was secured, Ukrainian forces positioned in the north at Sudzha could launch a coordinated assault on Belitsa from two directions.

The terrain configuration in the area worked to the Ukrainians’ advantage, as the Psel River effectively secured the northern flank of their main advance toward Giri. The Russians were unable to threaten the Ukrainian flanks in this sector due to the presence of only two bridges crossing the river.

These bridges were closely monitored by Ukrainian drones and protected by sabotage and reconnaissance units, ready to eliminate any Russian forces attempting to cross at these narrow chokepoints.

The Ukrainian assault forces advancing toward Giri moved swiftly along the highway from Plekhovo, seizing control of the nearby settlements of Borki, Spalnoye, Krupets, and Kamyshnoye with little to no Russian resistance.

However, the Russians had concentrated their forces just south of Belitsa, in Giri, where they staged a well-prepared ambush. This surprise attack inflicted losses on the Ukrainian formation, forcing them to retreat to Kamyshnoye.

The strong Russian resistance in Giri is due to the concentration of their limited forces in this area. To compensate for their scarcity, Russian troops were covertly deployed on the outskirts of towns with regional significance, such as Giri, which is only administratively separate from Belitsa.

However, the massing of Russian forces here means they are stretched thin and absent in other critical areas.

Given the concentrated Russian resistance near Giri, the Ukrainians decided to put their plans to capture Belitsa on hold and redirect their assaults toward Glushkovo, west of Sudzha, where Russian defenses are weaker and forces more dispersed.

To support further offensive operations in this area, Ukraine positioned a third assault formation along the international border southwest of the Sudzha bridgehead and south of Glushkovo. The Ukrainian command then activated these assault forces to launch a coordinated operation aimed at capturing Glushkovo from two axes of advance: one from Tyotkino and the other from Snagost.

At the border, Ukrainian forces began striking the settlement of Tyotkino using aerial attacks. Combat footage from the area shows that the Ukrainians deployed JDAM-guided bombs to target Russian positions in the village’s high-rise buildings. In response, the Russians attempted to counter by striking Ukrainian troop concentrations south of Tyotkino, aiming to disrupt the planned Ukrainian strike force.

By capturing Tyotkino, Ukrainian forces will gain access to the Tyotkino-Glushkovo highway, enabling them to deploy mobile units aboard Stryker armored vehicles for a swift advance toward Glushkovo from the southwest.

Simultaneously, Ukrainian forces concentrated in Snagost would advance along the opposite road, positioning themselves to assault Glushkovo from the east. Additionally, combat footage reveals that Ukrainian forces used HIMARS to strike a bridge over the Seym River near Glushkovo. The footage shows that the bridge was damaged, with further strikes likely to follow. The Ukrainians’ efforts to sever Russian logistics and reinforcements to Glushkovo strongly indicate that an offensive against the town is imminent.

Finally, to further limit the flow of capable Russian reinforcements to the northern Kursk region, Ukrainian forces launched an attack on the border village of Poloz in Belgorod. This move aims to pin down Russian units in the area, thereby depleting their defensive capabilities.

As a result, the Russian defensive efforts in the northern Kursk region will be further weakened, allowing the Ukrainians to accelerate their advance and expand their bridgehead.

Overall, the Ukrainian command initiated the second stage of the Kursk offensive operation to expand their bridgehead further from Sudzha towards Glushkovo. Expanding territories under Ukrainian control in this area will increase their space for deploying additional assault formations to launch even more powerfu assaults to advance to Rylsk and Lgov.


5,426 posted on 08/18/2024 3:51:32 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5420 | View Replies]

To: SpeedyInTexas; PIF; blitz128; BeauBo; marcusmaximus; FtrPilot; AdmSmith

This 44 minute day old video gives many up to date pieces of info regarding current Kursk activities. Various guests describe actions and plans of Ukraine for treatment and help to Kursk civilians including move to Ukraine for those who wish it, also description of Ukraine participation in Olympics at video’s end. Note: almost 500 athletes serving in Ukraine Army.

https://www.youtube.com/watch?v=DBEmPLmgM1I

To AdmSmith, welcome to this thread, but please notify the many who have been faithfully reading your thread, even if they have NOT commented much, with link to this thread.


5,427 posted on 08/18/2024 3:54:02 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 5417 | View Replies]

To: blitz128

Thanks


5,428 posted on 08/18/2024 3:54:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5422 | View Replies]

To: marcusmaximus

Kremlin snuff box, 08/18/24
https://t.me/s/kremlin_secrets

“It’s bad in the Kursk region, but there is one hope”

These words were told to us by a high-ranking source in the General Staff, commenting on the situation at the front.

According to him, “in the Kursk region, you need to tell the truth, now it’s a bad, difficult situation, which was the result of a series of mistakes.”

The military man believes that “almost the only ( unfortunately, this is what our interlocutor said - ed. ) opportunity to save the situation, and we are talking about the Ukrainian conflict in general, is to achieve success in another direction of the front.”

“In the Kursk region, everything will most likely drag on ( the source agrees with the forecasts of Andrei Belousov, which we wrote about - ed. ). Everyone is already saying this. At the same time, we are successfully moving forward in the Krasnoarmeysky ( Pokrovsky ) direction in the DPR. To be honest, I would stop lying and saying that we will soon resolve the Kursk issue. And he would take up the liberation of the DPR, since there are problems on a number of other sectors of the front,” the source said.

And the interlocutor at the Ministry of Defense admitted that quite strange conversations are increasingly common among generals. Like, it would be nice to transfer some troops from different sectors of the front to the Krasnoarmeyskoe direction in order to achieve results there. Because, despite all the heroic offensive and a number of serious successes, the situation there is still ambiguous.

The military has not yet expressed these proposals to Vladimir Putin. They are afraid that the President will suspect them of intentions to surrender the Kursk region to the enemy.


5,429 posted on 08/18/2024 3:54:23 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5409 | View Replies]

To: AdmSmith

Welcome aboard!!

Just to clear up any confusion. So the “Russian Military ...” thread will no longer be maintained?

Just watch the trolls who show up. Try not to interact, as the interaction is like meat to flies - it breeds more of them quickly.


5,430 posted on 08/18/2024 3:59:33 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5428 | View Replies]

To: gleeaikin

There is a notification on his site that he will be posting here from now on, but a bit downplayed as his notification here was😂

We will see how far down in his post people read and understood

Not flipping back and forth will be nice


5,431 posted on 08/18/2024 4:53:32 AM PDT by blitz128
[ Post Reply | Private Reply | To 5427 | View Replies]

To: PIF

Great point, I am as guilty as others but now try to respond to the usuals like wildberry to others like yourself so they don’t get the clicks.

Hope this doesn’t bother folks, if it does please let me know


5,432 posted on 08/18/2024 4:55:37 AM PDT by blitz128
[ Post Reply | Private Reply | To 5430 | View Replies]

To: AdmSmith
Russian blogger:

Important clarification about the battles in the Kursk region

Several sources immediately indicate that the Ukrainian Armed Forces’ offensive has slowed down. Units of the brigades that were actively advancing in the first days of the Kursk breakthrough have been withdrawn to the rear. They have been replaced by other units. [comment: Contrary to what the Russian Army is doing with their resources]

A number of sources erroneously believe that Kiev has thrown all available reserves into the Kursk direction. This is not true. We have repeatedly written that Kiev has some troops that are outside of Ukraine. Since they are scattered across many countries, it is difficult to calculate the total number of Ukrainian Armed Forces’ foreign reserves. Separately, we note that intelligence records a buildup of reserves in another direction. The competent authorities are aware of this, so we will not write more details.

Regarding the Kursk region, it is important to emphasize that the Russian Armed Forces have practically not withdrawn units from the Pokrovsky and Toretsky directions in the DPR, as Kiev expected. [not correct description] But this also influenced the fact that the Ukrainian Armed Forces continued their offensive and are managing to dig in on the captured territory. Thus, we find ourselves in a situation where we will have to drive the enemy out of our territories. And this will lead to the destruction of cities and towns in the Kursk region. The picture is not very good for our fellow citizens. [This is the way Russia is conducting war - destroy everything]

For now, the authorities have decided to introduce a counter-terrorist operation regime in order to separate the regions with military operations from the rest of Russia. “The breakthrough of the Ukrainian Armed Forces in the Kursk region was a shock for us. It was necessary to urgently calm the population. A decision was made to “separate” these regions for a while, at least informationally,” a source in the political bloc of the Presidential Administration told us.

As for the currently uncontrolled regions, the authorities are not ready to give forecasts about the timing of their liberation. In this regard, there is increasing talk about the need for a new mobilization. [Yes, please] The population's preparation for this unpopular step can be seen in the rhetoric of TV and war correspondents.

https://t.me/kremlin_secrets/4533

continuation of this https://freerepublic.com/focus/news/4042550/posts?page=6952#6952

5,433 posted on 08/18/2024 5:54:09 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5419 | View Replies]

To: AdmSmith

I seems to me that the Russians plan is to make gains in Donbas…. , and believe that the “incursion “ in Kursk can be dealt with later.

Right now I don’t believe they have enough forces to pull combat units from those fronts to deal with Kursk and just hope that the Ukranians will run out of steam.


5,434 posted on 08/18/2024 6:12:42 AM PDT by blitz128
[ Post Reply | Private Reply | To 5433 | View Replies]

To: PIF; All
The Air Force reported on the attack overnight, mainly aimed for Kyiv and its region.

Shot down:

2/2 KN-23 ballistic missiles
0/1 Iskander-M ballistic missiles
0/2 Kh-59 cruise missiles
3/3 Unspecified cruise missiles
8/8 Shahed drones

“The rest of the missiles that were not included in the downed statistics did not reach the desired targets. Previously, there were no casualties or casualties,” they added.

https://x.com/NOELreports/status/1825059944342634623


5,435 posted on 08/18/2024 6:14:53 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5430 | View Replies]

To: AdmSmith

Welcome aboard!


5,436 posted on 08/18/2024 6:20:10 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5433 | View Replies]

To: FtrPilot

Andrei Belousov. Current Russian MoD
5,437 posted on 08/18/2024 6:29:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5436 | View Replies]

To: PIF; All
Kursk Offensive: Ukrainian Special Forces covertly entered Russia before the main forces. This is their footage.

https://x.com/igorsushko/status/1824703396164800999

Very interesting 3 minute gopro video at the link.

5,438 posted on 08/18/2024 6:41:22 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5437 | View Replies]

To: PIF
Ukrainian UAVs hit the fuel depots in Proletarsk, Rostov region, in Russia.

Two huge smoke plumes can be seen.

https://x.com/Tendar/status/1825022504659714369


5,439 posted on 08/18/2024 6:47:44 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5438 | View Replies]

To: AdmSmith

“there is increasing talk about the need for a new mobilization.” (In Russia)

They have done it before in September. There may be a cyclical reason for that timing, like there is for their annual conscription call up each Spring.


5,440 posted on 08/18/2024 7:59:50 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5433 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,401-5,4205,421-5,4405,441-5,460 ... 7,421-7,440 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson