Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,561-22,58022,581-22,60022,601-22,62022,621-22,625 next last
To: kiryandil
He's a jack'assin' wonky pickle, a gibberish-spouting toaster, a lumpy sock puppet with no charisma, a moldy meatball rolling in glitter, a soggy waffle, a lopsided kumquat, and a walking fart symphony with no rhythm. Take THAT CINO!!
22,601 posted on 11/30/2025 7:25:36 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22551 | View Replies]

To: kiryandil
Those were the days my friend
We thought they'd never end
We'd sing and dance forever and a day
We'd live the life we choose
We'd fight and never lose
Those were the days
Oh, yes, those were the days

Disclaimer of Rooskie disinformation: " 'Those Were the Days' is a song composed by Boris Fomin (1900–1948) but credited to Gene Raskin, who put a new English lyric to Fomin's Russian romance song 'Dorogoi dlinnoyu',[a] with words by the poet Konstantin Podrevsky. The song is a reminiscence of youth and romantic idealism. It also deals with tavern activities, which include drinking, singing, and dancing."

Source: Those Were the Days (song) Wiki


22,602 posted on 11/30/2025 7:27:20 AM PST by Worldtraveler once upon a time (Degrow government)
[ Post Reply | Private Reply | To 22591 | View Replies]

To: blitz128
stop supporting BlueSky


22,603 posted on 11/30/2025 7:28:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22601 | View Replies]

To: blitz128; JonPreston
LOL! - check it out - The Jerk [ajerk-now] is even attacking his own pals.

Got to get up early in the morning to out-Jerk The Jerk.


22,604 posted on 11/30/2025 7:28:30 AM PST by kiryandil (No one in AZ that voted for Trump voted for Gallego )
[ Post Reply | Private Reply | To 22597 | View Replies]

To: Worldtraveler once upon a time

Happy Thanksgiving and Happy Holidays to you and yours! 🙂


22,605 posted on 11/30/2025 7:31:11 AM PST by kiryandil (No one in AZ that voted for Trump voted for Gallego )
[ Post Reply | Private Reply | To 22602 | View Replies]

To: kiryandil

Try again


22,606 posted on 11/30/2025 7:34:09 AM PST by blitz128
[ Post Reply | Private Reply | To 22604 | View Replies]

To: JonPreston

“Former CIA officer”?🤔


22,607 posted on 11/30/2025 7:35:41 AM PST by blitz128
[ Post Reply | Private Reply | To 22599 | View Replies]

To: blitz128; JonPreston
ajerkyes wrote TO YOU, blintzboy: Try again, because that last try was not nice.
22,608 posted on 11/30/2025 7:36:29 AM PST by kiryandil (No one in AZ that voted for Trump voted for Gallego )
[ Post Reply | Private Reply | To 22606 | View Replies]

To: JonPreston

Too many blintzes reduces the IQ, I guess.


22,609 posted on 11/30/2025 7:37:08 AM PST by kiryandil (No one in AZ that voted for Trump voted for Gallego )
[ Post Reply | Private Reply | To 22603 | View Replies]

To: JonPreston

22,610 posted on 11/30/2025 7:38:02 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22586 | View Replies]

To: kiryandil
--- "Happy Thanksgiving and Happy Holidays to you and yours! 🙂"

Wishes returned, fourteenth of Gondor. When we were legal residents in Germany, we used to gather various expat "orphans" because Thanksgiving Day was not a holiday there. Giving thanks for so much.

22,611 posted on 11/30/2025 7:38:55 AM PST by Worldtraveler once upon a time (Degrow government)
[ Post Reply | Private Reply | To 22605 | View Replies]

To: dennisw

To: JonPreston

Do this again and I will push the abuse button.


22,284 posted on 11/20/2025 7:59:34 AM PST by dennisw (There is no limit to human stupidity / )

22,612 posted on 11/30/2025 8:00:42 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22610 | View Replies]

To: blitz128
Imagine kidnapped Ukrainian children would be first

I was going to mention them in my prior post, but then I figured that it would be Putin/Russia admitting to a war crime, and Putin still doesn't want people accusing him or war crimes.
22,613 posted on 11/30/2025 8:09:11 AM PST by adorno ( )
[ Post Reply | Private Reply | To 22528 | View Replies]

To: dennisw; adorno; blitz128; BeauBo
❗️Ukrainian military from the Aerobomber_UA strike aerial reconnaissance group destroy Russian fiber-optic FPV drones waiting in ambush

https://bsky.app/profile/militarynewsua.bsky.social/post/3m6tpmzpzd22j
1 min video

22,614 posted on 11/30/2025 8:10:22 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22610 | View Replies]

To: AdmSmith
Ukrainian military from the Aerobomber_UA strike aerial reconnaissance group destroy Russian fiber-optic FPV drones waiting in ambush

More "Russian" casualties. ;-)

They don't even know how to hide well.
22,615 posted on 11/30/2025 8:23:40 AM PST by adorno ( )
[ Post Reply | Private Reply | To 22614 | View Replies]

To: PIF; gleeaikin; BeauBo; adorno; blitz128
Earlier “The church is preparing to urgently send 600 priests to the front”, today:

Кремлевская табакерка
30NOV202

The Church is recalling priests who were previously sent to oil refineries to pray for their protection

According to our source in the Church, priests were sent to a number of oil refineries and other important enterprises to conduct special prayers on site for their protection from enemy attacks. Priests are being recalled from more than a dozen oil refineries.

“It has become dangerous to be at a number of oil refineries. Prayers do not always save when air defense fails. We are forced to recall our priests from 11 enterprises. We hope that the situation will improve and they will return there,” said a source close to Patriarch Kirill. This decision will almost certainly cause discontent in the Kremlin. There, it seems, they will think about how to find leverage and return the clergy to the refineries — “so that their prayers to God can help where no other protection works.” What this leverage will be is still unknown.

https://t.me/kremlin_secrets/6483

but we know: https://attwnmgp.weebly.com/ten-little-soldier-boys.html

22,616 posted on 11/30/2025 8:52:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22445 | View Replies]

To: PIF; gleeaikin
Кремлевская табакерка
30NOV2025

“Total mobilization in Russia should start on March 1.”

This prediction was made by philosopher Alexander Dugin in a conversation with us. “President Putin has chosen war, and it will last for about another 20 years. Next year, the war will become total. Everything will be total—mobilization, combat operations. A total struggle for birth rates will also begin, because new soldiers must be conceived and born now in order to be able to take part in this war,” Alexandr Gelevich said.

He predicts that next year the army will be replenished by about 1.5 million people. According to the philosopher, this mobilization will begin on March 1. It should be noted that Dugin had previously predicted the start of total mobilization in Russia on February 1 of next year. When asked why the dates had been changed, he replied, “We need time to prepare.”

The Kremlin declined to comment on these words. The Ministry of Defense noted that they are always ready for mobilization measures, as this is one of their tasks. However, they did not say how “total” such measures might be. Alexandr Gelevich urges people to trust his predictions. He notes that he is one of the few who, “amidst incomprehensible cries and predictions about peace,” predicted that Vladimir Putin would choose to continue the special military operation and wage a “long, heroic, real war.”

https://t.me/kremlin_secrets/6485

22,617 posted on 11/30/2025 8:59:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22510 | View Replies]

To: adorno
🌐The oil tanker M/T Mersin is sinking off the coast of Senegal.

The chemical and oil tanker M/T Mersin (IMO 9428683, deadweight 50,000 DWT, built 2009) began sinking today in the North Atlantic approximately 70-100 km from the Senegalese capital Dakar.

The Panamanian-flagged ship, owned by the Turkish company Beşiktaş Shipping, was en route from the Russian port of Taman, where it loaded up to 50,000 tons of petroleum products in August 2025, to Dakar. According to available information, the crew reported water entering the engine room shortly before noon local time, followed by loss of stability and a strong list. The last AIS signal received was from November 24, 2025 from coordinates 14.608° N, 17.279° W, where the ship had been stationary for several days.

Senegalese maritime rescue services were immediately dispatched to the scene. Initial reports indicate that the entire crew was evacuated; no injuries or fatalities have been reported. The cause of the hull breach remains unknown. Authorities and the shipowner have yet to issue an official statement on the possible cause – whether a technical fault, collision or other incident. The M/T Mersin has repeatedly transported oil and oil products from Russian Black Sea ports in the past, making it one of the vessels often described as part of Russia's “shadow fleet” to evade Western sanctions. This has led to speculation that it was a targeted attack, but there is no evidence to support this. The threat of an oil spill has not yet been confirmed, but Senegalese authorities are preparing measures in case of an environmental accident. The situation is being monitored.

https://x.com/geogeolite/status/1995138612837458373
1 min video

22,618 posted on 11/30/2025 9:17:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22615 | View Replies]

To: JonPreston
Jim Carrey Stupid Stupid GIF - Jim Carrey Stupid Stupid Dumb And Dumber ...
22,619 posted on 11/30/2025 10:32:40 AM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22612 | View Replies]

To: dennisw
You BlueSky posters didn't see this one coming?


22,620 posted on 11/30/2025 10:35:39 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22619 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,561-22,58022,581-22,60022,601-22,62022,621-22,625 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson