Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,121-22,14022,141-22,16022,161-22,18022,181 next last
To: dennisw

“Then there are two other berths unscathed” (at Sheskharis oil terminal in Novorossisyk)

A couple of more volleys…


22,141 posted on 11/17/2025 5:04:42 AM PST by BeauBo
[ Post Reply | Private Reply | To 22129 | View Replies]

To: BeauBo; blitz128

For OSINT Open Railway Map is a detailed online map of the world’s railway infrastructure, built on OpenStreetMap data. It has been available since mid-2013

https://www.openrailwaymap.org/

https://wiki.openstreetmap.org/wiki/OpenRailwayMap


22,142 posted on 11/17/2025 5:31:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22141 | View Replies]

To: BeauBo
🛢️ Russia's flagship oil price plunged to the lowest in over 2 1/2 years last week, - Bloomberg

The price of the nation's Urals grade plunged as low as $36.61 a barrel from the Black Sea port of Novorossiysk. Discounts on Urals deepened to an average of $23.52 a barrel against the Brent benchmark.

https://bsky.app/profile/maks23.bsky.social/post/3m5tcfijphs25

22,143 posted on 11/17/2025 5:41:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22141 | View Replies]

To: gleeaikin

Google, like other Western media, is blocked by Russia. So of course you will not find anything in a search of Western media.

There are only a few holes like Telegram channels in Russian.


22,144 posted on 11/17/2025 6:06:09 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22127 | View Replies]

To: gleeaikin

... but researchers have never found Genghis Khan’s remains or directly tested his DNA. The connection is a strong statistical inference based on historical and genetic evidence.


In layman’s language, its totally worthless.


22,145 posted on 11/17/2025 6:09:46 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22130 | View Replies]

To: mcdonald; idiot
🍈

😂😂😂😂

🤡


22,146 posted on 11/17/2025 7:17:09 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22145 | View Replies]

🍈

😂😂😂😂

🤡

(Mc) 🍈

😂😂😂😂

🤡


22,147 posted on 11/17/2025 7:17:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22146 | View Replies]

To: blitz128
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

22,148 posted on 11/17/2025 7:18:38 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22147 | View Replies]

To: JonPreston
"Who He?"

(R)

🚨 HOLY SMOKES! Trump just TORCHED the globalists at the G7 for facilitating the Ukraine-Russia war by preventing diplomacy with Russia.

"The G7 used to be the G8. Barack Obama and a person named Trudeau didn't want to have Russia in, and I would say that was a mistake, because…
pic.twitter.com/uI9aRLq3h8— Eric Daugherty (@EricLDaugh) June 16, 2025


22,149 posted on 11/17/2025 7:20:37 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22148 | View Replies]

To: JonPreston
Where is FtrPilot? marcusmaximus??


22,150 posted on 11/17/2025 7:21:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22149 | View Replies]

To: BeauBo
Where is FtrPilot? marcusmaximus??


22,151 posted on 11/17/2025 7:22:08 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22150 | View Replies]

To: AdmSmith

1990s only worse, then it was just corruption, disrepair, theft, and low oil prices, now they have western and ukranian sanctions on top of them

Apparently firing off waves of memes is the only defense the muscovites have left😂

Without money to grease the palms pitin better stay away from windows, of course few windows in his bunkers😂😂😂


22,152 posted on 11/17/2025 8:00:30 AM PST by blitz128
[ Post Reply | Private Reply | To 22143 | View Replies]

To: Bums

22,153 posted on 11/17/2025 8:03:39 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22151 | View Replies]

To: Buffoon
🍈

😂😂😂😂

🤡


22,154 posted on 11/17/2025 8:07:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22153 | View Replies]

To: blitz128
You, sir, are to be commended for continuing your education despite obvious mental incapacities

For your effort, I award you a juicy melon and a string a happy faces!

🍈

😂😂😂😂


22,155 posted on 11/17/2025 8:13:00 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22152 | View Replies]

To: blitz128

I really did not think it possible, but the kid is getting even more juvenile. Perhaps it is regressing from 2nd grade to kindergarten [ assuming it even left in the first place. ]


22,156 posted on 11/17/2025 9:26:17 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 22152 | View Replies]

To: PIF
PIF, what have you done with FtrPilot and marcusmaximus?

November 17, 2025
Ukraine Is Buying Fighter Jets With Money It Does Not Have?

Over the next two years Ukraine plans to spend some €140 billion ($162b) it does not have to continue its war with Russia. There is serious doubt that the European Union, which has already shuffled €180 billion ($216b) to Ukraine, will be able to pay even a fraction of that.

Despite Ukraine’s lack of money it acting president Vladimir Zelenski is announcing deals to procure expensive military aircraft at an unprecedented scale.

In late October he went to Sweden to buy JAS 39 Gripen-E multi-role fighter jets build by Saab:

Ukraine could get 150 advanced Swedish fighter jets under just-signed dealCNN, Oct 23 2025

New NATO member Sweden has said it is willing to sell Ukraine up to 150 of its most advanced fighter jets, the first offer from a member of the alliance to supply significant numbers of jets to Kyiv, which is seeking to upgrade its small and ageing air force.

The deal signed on Wednesday by Volodymyr Zelensky and Swedish Prime Minister Ulf Kristersson is a letter of understanding, meaning exact terms, costs and delivery dates for 100 to 150 Saab Gripen-E jets are yet to be determined.

But both leaders said it has the potential to be a game changer, not only for Ukraine – which desperately needs more air combat capabilities in its fight against Russia – but for NATO and European security overall.

The planes ain’t cheap:
Cont. reading: Ukraine Is Buying Fighter Jets With Money It Does Not Have?


22,157 posted on 11/17/2025 9:30:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22156 | View Replies]

To: PIF
Кремлевская табакерка

Belousov fears Putin's wrath. The Minister of Defense began to pray more often and is thinking about mobilization

We wrote: the president is very dissatisfied with the fact that the military cannot protect our refineries from enemy strikes. Andrei Belousov fears that Vladimir Putin's anger will be directed against him personally. And he thinks about what to do in this situation. “Unfortunately, we will not protect the refinery right now and completely. And Andrei Belemovich understands this. But he is thinking about other actions, the results of which will please Vladimir Vladimirovich. In particular, about how to completely liberate the DPR as soon as possible. In this regard, Andrei Removich is even inclined to ask the president to announce mobilization, and as soon as possible,” a source in Belousov’s entourage told us.

He also said that the head of the Ministry of Defense “would not mind praying together with Vladimir Vladimirovich near the relics of Mother Matronushka of Moscow.” But he does not know whether it will be possible to do this. Another interlocutor close to the Minister of Defense confirmed that Belousov was worried. “But he began to pray more. God will help Andrei Removich and suggest a way out of a difficult situation,” the source is sure.

https://t.me/kremlin_secrets/6430

22,158 posted on 11/17/2025 9:54:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22156 | View Replies]

To: AdmSmith
Belousov fears Putin's wrath. The Minister of Defense began to pray more often and is thinking about mobilization We wrote: the president is very dissatisfied with the fact that the military cannot protect our refineries from enemy strikes. Andrei Belousov fears that Vladimir Putin's anger will be directed against him personally. And he thinks about what to do in this situation. "Unfortunately, we will not protect the refinery right now and completely. And Andrei Belemovich understands this. But he is thinking about other actions, the results of which will please Vladimir Vladimirovich. In particular, about how to completely liberate the DPR as soon as possible. In this regard, Andrei Removich is even inclined to ask the president to announce mobilization, and as soon as possible," a source in Belousov's entourage told us. He also said that the head of the Ministry of Defense "would not mind praying together with Vladimir Vladimirovich near the relics of Mother Matronushka of Moscow." But he does not know whether it will be possible to do this. Another interlocutor close to the Minister of Defense confirmed that Belousov was worried. "But he began to pray more. God will help Andrei Removich and suggest a way out of a difficult situation," the source is sure. Kremlin snuffbox">
22,159 posted on 11/17/2025 11:10:24 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22158 | View Replies]

To: AdmSmith
it differs from the original Russian

Белоусов опасается гнева Путина. Министр обороны стал чаще молиться и задумывается о мобилизации Мы писали: президент очень недоволен тем, что военные не могут защитить наши НПЗ от ударов врага. Андрей Белоусов опасается, что гнев Владимира Путина будет направлен лично против него. И думает, что делать в этой ситуации. «НПЗ прямо сейчас и полностью мы, к сожалению, не защитим. И Андрей Рэмович это понимает. Но он размышляет над другими действиями, результаты которых понравятся Владимиру Владимировичу. В частности, о том, как поскорее полностью освободить ДНР. В связи с этим Андрей Рэмович даже склоняется к тому, чтобы попросить президента объявить мобилизацию, причем в максимально сжатые сроки», - рассказал нам источник в окружении Белоусова. Он также сообщил, что глава Минобороны «был бы не против вместе с Владимиром Владимировичем помолиться возле мощей матушки Матронушки Московской». Но не знает, получится ли это сделать. Другой собеседник, близкий к министру обороны, подтвердил, что Белоусов переживает. «Но он стал больше молиться. Бог поможет Андрею Рэмовичу и подскажет выход из сложной ситуации», - уверен источник. Кремлевская табакерка">

22,160 posted on 11/17/2025 11:11:17 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22159 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,121-22,14022,141-22,16022,161-22,18022,181 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson