Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,081-22,10022,101-22,12022,121-22,14022,141-22,155 next last
To: JonPreston
1 To Stupid GIFs - Find & Share on GIPHY
22,121 posted on 11/16/2025 5:07:32 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22116 | View Replies]

To: dennisw

22,122 posted on 11/16/2025 5:30:09 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22121 | View Replies]

To: BeauBo; dennisw; blitz128; marcusmaximus; ETCM

I have just finished reading your excellent link. I strongly recommend it to anyone who would wish to understand the complexity of attacks on both petroleum and electrical energy production. This details pros and cons of Ukraine attacks on Russia and Russian claimed Ukraine territory and of Russian attacks on Ukraine cities and territory. This article which covers attacks up to Nov. 6th speculates on potential effects of lights out in Moscow, and compares the 2005 Moscow lights out event caused by Russian failure to modernize.

Obviously it cannot discuss the ONE NIGHT lights out Ukraine delivered to Moscow a few days ago, so perhaps this latest event was a dress rehearsal for the MULTI NIGHT lights out the article suggest will happen by the end of this year. It is pointed out that Ukraine has an “extension cord” to gain electrical help from Europe, whereas Russia has no such outside help with electrical energy. Views of Ukraine supporters who feel this approach of combined energy attacks will have a key effect on winning this war are evaluated by others (in particular a banker) who feel that while useful, this approach is incomplete as a key to final victory.

Link referred to here and in comment replied to: https://www.ukrinform.net/rubric-ato/4056716-can-ukraine-black-out-russia-in-winter.html


22,123 posted on 11/16/2025 6:47:41 PM PST by gleeaikin (Question Authority: report facts, and post their links in your message.)
[ Post Reply | Private Reply | To 22061 | View Replies]

To: BeauBo; blitz128; dennisw; adorno; ETCM; marcusmaximus; SpeedyInTexas

Belarus might have the technical capability to send electrical help to some parts of Russia like Kursk and Belgorod which had recent lights out events. However, given recent apparent unwillingness to allow Russia to use land travel to bring goods by truck to and from Kaliningrad, this may be wishful thinking if Russia has such thoughts. The other question is whether Belarus has such technical capability? Technical information from others would be appreciated.


22,124 posted on 11/16/2025 6:57:39 PM PST by gleeaikin (Question Authority: report facts, and post their links in your message.)
[ Post Reply | Private Reply | To 22093 | View Replies]

To: gleeaikin

The Mother of All Bone-Crushing Sanctions, is back on the table.

Kyiv Independent (17 Nov):

“U.S. President Donald Trump said on Nov. 16 that congressional Republicans are preparing legislation that would impose sanctions on any country doing business with Russia.

“Any country that does business with Russia will be very severely sanctioned,” Trump told reporters in Palm Beach, Florida. He added that Iran may also be included in the new sanctions package.”


22,125 posted on 11/16/2025 10:27:14 PM PST by BeauBo
[ Post Reply | Private Reply | To 22123 | View Replies]

To: dennisw

Novorossisyk is loading oil again, after a two day halt.

The berths that were hit will be out longer, but the Transneft pipeline supplying the whole facility has apparently been restored,


22,126 posted on 11/16/2025 10:40:45 PM PST by BeauBo
[ Post Reply | Private Reply | To 22122 | View Replies]

To: BeauBo

Do you have a link, source, or suggestion as to where one finds info about this Cuckoo project. Early this month I Googled a question about this Russian project and was told there is NO SUCH THING.

I just tried again and entered “information about the planned Russian cuckoo project to mate women with politicians and war heroes to breed state warriors” Nothing came in reference to this project. The first item listed was about an old entertainment (movie?) with a vaguely similar plot.


22,127 posted on 11/16/2025 11:06:50 PM PST by gleeaikin (Question Authority: report facts, and post their links in your message.)
[ Post Reply | Private Reply | To 22111 | View Replies]

To: BeauBo

There are 4 berths for oil tankers. Berths #1 and #1A were hit. This leaves 2 others. Russkies have patched things up enough to enable limited and slower loading oil onto tankers. Of course Russkies want to show business back to usual for PR reasons. Mew satellite images are needed to see what berths are functional enough today to have an oil tanker loading next to it.

If I were Vlad I would tell the port to position tankers by the terminals, even if the port is unable to pump oil into them. Potemkin style.
-
-
-
-
-
-
-
-
-
AI>>>>>

Authoritative sources (NCSP Group, port specifications, shipping agencies) list 3–4 oil tanker berths at Sheskharis:

Berth 1A – ~110–140k DWT

Berth 1 – ~160–170k DWT

Berth 2 – petroleum products

Sometimes Berth 3 is listed depending on classification, but not always used for crude.

___________________

Current Status After the Attack

Damage to Berths

Two berths were hit in the strike: Berth 1 and Berth 1A.
Reuters
+2
United24 Media
+2

These are major oil-loading berths: sources say 1 handles ~40,000 dwt ships and 1A ~140,000 dwt.
LIGA.net
+2
United24 Media
+2

Satellite imagery shows damage to loading infrastructure, measurement systems, pumping lines, trestles, etc.
United24 Media


22,128 posted on 11/16/2025 11:09:32 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22126 | View Replies]

To: BeauBo

My guess is that these Novorossisyk oil tanker berths (#1 and #1A) are charred n twisted metal wreckage. But with intensive jerry rigging, they are now functional enough to pump crude onto tankers at one third to one half the normal speed.

Then there are two other berths unscathed. Prolly can only take on smaller oil tankers.


22,129 posted on 11/16/2025 11:18:57 PM PST by dennisw (There is no limit to human stupidity / )
[ Post Reply | Private Reply | To 22126 | View Replies]

To: BeauBo; AdmSmith; dennisw; blitz128

“Maybe they will be Putin’s children... Surprise!” Why not, look at the figure for Genghis Khan’s descendents. I would not be surprised if Putin was one of them.

“AI OVERVIEW:

An estimated 16 million men worldwide, or about 0.5% of the global male population, are believed to be direct male-line descendants of Genghis Khan. This is because a 2003 study found they share a nearly identical Y-chromosome lineage, which is passed from father to son. The rapid and widespread distribution of this Y-chromosome is linked to the expansion of the Mongol Empire, where his male descendants and relatives had many children across the vast territories they controlled.
* Genetic evidence: A 2003 study found a specific Y-chromosome lineage present in about 8% of men in a large region of Asia, from Northeast China to Uzbekistan.
* Estimated number: Assuming this sample is representative, the study estimated it translated to approximately 16 million men globally at the time, or about 0.5% of the world’s male population.
* Reason for spread: The lineage spread due to the social and political structure of the Mongol Empire, where Genghis Khan and his male relatives had many children through multiple wives and concubines.
* Limitations: This estimate only accounts for male descendants because the Y-chromosome is passed down patrilineally. Female descendants with other ancestries are not included in this count.
* Lack of Direct DNA: It is important to note that the specific Y-chromosome haplogroup (a branch of the human family tree) is linked to the Khan’s era and region, but researchers have never found Genghis Khan’s remains or directly tested his DNA. The connection is a strong statistical inference based on historical and genetic evidence.
* Total Descendants: The 16 million figure only includes direct male-line descendants. The total number of people who have any amount of Genghis Khan’s DNA through both male and female lines is much larger and difficult to estimate accurately due to genetic dilution over many generations.”


22,130 posted on 11/16/2025 11:24:45 PM PST by gleeaikin (Question Authority: report facts, and post their links in your message.)
[ Post Reply | Private Reply | To 22111 | View Replies]

To: PIF; BeauBo; blitz128; gleeaikin; Dot; adorno; Timber Rattler; dennisw; marcusmaximus; ETCM
Russian Offensive Campaign Assessment, November 16, 2025

Russian forces are attempting to complete their encirclement of Ukrainian forces in Pokrovsk and Myrnohrad. Russian forces’ recent attempts to infiltrate Ukrainian lines north of Pokrovsk indicate that Russian forces are prioritizing efforts to complete the encirclement, aiming to physically sever Ukrainian ground lines of communication (GLOCs) north of Pokrovsk that supply forces in Pokrovsk and Myrnohrad (east of Pokrovsk). This assessment modifies ISW’s previous observation that Russian forces were apparently focusing on seizing the town of Pokrovsk rather than on completing the encirclement.[1] Geolocated footage published on November 16 indicates that Russian forces recently conducted a roughly fireteam-sized infiltration mission north of Pokrovsk.[2] A Russian milblogger claimed that Russian forces conducted the infiltration mission northward from Pokrovsk itself.[3] ISW assesses that Ukrainian forces killed or wounded the Russian forces involved. It is unclear, therefore, if Russian forces retain positions in this area. The spokesperson of a Ukrainian brigade operating in the Pokrovsk direction reported on November 16 that Russian forces have reverted to conducting infiltrations into Pokrovsk in small infantry groups of two to three servicemembers instead of mechanized assaults, likely in reaction to the failure of such assaults.[4] A Ukrainian servicemember operating in the neighboring Kostyantynivka-Druzhkivka tactical area told CNN on November 16 that the size of Russian infiltration groups has recently dropped from five to seven servicemembers to a maximum of three servicemembers.[5] A Ukrainian drone operator in the Pokrovsk direction told CNN that Russian forces’ infiltration tactics are predicated on the assumption that lone survivors of three-member infiltration groups can gain footholds, emphasizing the costly nature of such tactics. The failure of mechanized assaults to rapidly bring large numbers of Russian forces into the town and the costly nature of infiltration-based troop accumulation may constrain Russian forces’ ability to reinforce troops within Pokrovsk, delaying Russian forces’ seizure of the town.

Foggy conditions impede both sides’ operations, and both sides have developed approaches to mitigate their effects. A Russian milblogger acknowledged that foggy weather conditions disadvantage Russian as well as Ukrainian forces.[6] The milblogger noted that Ukrainian forces are able to exit Pokrovsk under the cover of fog and that foggy conditions are impeding Russian drone operations – likely facilitating continued Ukrainian logistics to Pokrovsk and Myrnohrad. A Ukrainian mechanized brigade operating in the neighboring Kostyantynivka-Druzhkivka tactical area reported that Ukrainian forces employed unmanned ground vehicles (UGVs) to detect a Russian mechanized assault toward Rusyn Yar (south of Druzhkivka) that exploited foggy conditions.[7] The brigade reported that the UGVs then transmitted coordinates for first-person view (FPV) drone strikes that repelled the mechanized assault, indicating that Ukrainian forces are developing countermeasures to Russian forces’ exploitation of foggy conditions to launch assaults.[8] Foggy conditions are seasonal and will lift at some point, and it is unclear which side will benefit more from clearer weather.

The logistical situation for Ukrainian forces in Pokrovsk and Myrnohrad remains difficult. The Ukrainian combat medic operating in the Pokrovsk and Myrnohrad area told CNN that Russian drone fire control of Ukrainian GLOCs leading to Pokrovsk and Myrnohrad prevents Ukrainian vehicles from moving closer than 10 to 15 kilometers from Pokrovsk, hindering casualty evacuation efforts.[9] The medic noted that Russian forces focused fire on Red Cross-marked UGVs that Ukrainian forces use for casualty evacuation in violation of international law.

The situation in the Hulyaipole direction remains very serious as Russian forces continue to advance and maintain intensified offensive operations. Russian forces are attempting to isolate Hulyaipole from the northeast, likely to support Russian efforts to seize the town from the east. Russian forces continued to advance toward Hulyaipole and the T-0401 Pokrovske-Hulyaipole highway, which is one of Ukraine's main GLOCs supplying Hulyaipole. Geolocated footage published on November 15 and 16 indicates that Russian forces recently seized Rivnopillya (northeast of Hulyaipole) and advanced east of Zatyshshya (east of Hulyaipole) along the O-080618 Hulyaipole-Malynivka highway.[10] The Russian Ministry of Defense (MoD) credited elements of the Russian 114th Motorized Rifle Regiment (127th Motorized Rifle Division, 5th Combined Arms Army [CAA], Eastern Military District [EMD]) with seizing Rivnopillya.[11] Recent Russian advances bring Russian forces within a roughly eight-kilometer range northeast of Hulyaipole and within about four kilometers east of Hulyaipole. Ukrainian Southern Defense Forces Spokesperson Colonel Vladyslav Voloshyn acknowledged on November 15 that recent Russian advances threaten to cut off Hulyaipole from GLOCs, including the T-0401 highway.[12] Voloshyn noted that Russian forces are attempting to infiltrate northwest of Hulyaipole toward Varvarivka, which runs directly along the T-0401 highway. A source reportedly affiliated with Ukrainian military intelligence stated on November 15 that Russian infiltration operations in the Hulyaipole direction can now penetrate into Ukrainian defenses up to five kilometers past the frontline.[13] Elements of the Russian 38th Motorized Rifle Brigade (35th CAA, EMD) appear to be operating near Zelenyi Hai (east of Hulyaipole), confirming that the Russian military command redeployed elements of the 38th Motorized Rifle Brigade from positions south of Hulyaipole to reinforce efforts east of Hulyaipole.[14]

Ukrainian forces report that they are successfully pushing back Russian efforts to seize Kupyansk. These reports are generally consistent with ISW’s assessments. Ukraine's Joint Forces Task Force reported on November 16 that Ukrainian forces control Kupyansk and that Ukrainian forces have cut off Russian forces in northern Kupyansk from logistics.[15] Ukraine's Joint Forces Task Force noted that Russian forces are attempting to claim successful advances through fabricated flag raisings that Russian soldiers on the ground conduct with flags received in drone drops and supply packages. The Russian Ministry of Defense (MoD) claimed on November 16 that Ukrainian forces counterattacked near Osynovo (south of Kupyansk) and Zapadne (north of Kupyansk).[16] Russian milbloggers claimed that Ukrainian forces counterattacked from western Kupyansk and that Ukrainian sabotage and reconnaissance groups are infiltrating the town.[17] Russian Chief of the General Staff Army General Valery Gerasimov claimed on August 30 that Russian forces seized roughly 50 percent of Kupyansk, and on October 26 that Russian forces encircled 18 Ukrainian battalions in Kupyansk.[18] ISW assessed that both claims were exaggerations of Russian gains in Kupyansk. The Joint Forces Task Force report suggests that Ukrainian forces are in the process of successfully rolling back a Russian effort to seize a settlement at this scale for the first time in recent years.

The Kremlin used an interview with Kremlin-affiliated former Ukrainian Verkhovna Rada Deputy Viktor Medvedchuk to reiterate Russia's objective of absorbing all of Ukraine into Russia – possibly under the control of Medvedchuk himself. Medvedchuk's statements are consistent with ISW’s assessments that Russia aims to absorb all of Ukraine and with US President Donald Trump's statements that Putin “wants all of it.”[19] Medvedchuk — a close personal ally of Putin, whom Putin initially wanted to install in place of Ukrainian President Volodymyr Zelensky following Russia's full-scale invasion, claimed in an interview that Kremlin newswire TASS published on November 15 that he believes that Ukraine will not “survive as a state” in the future.[20] Medvedchuk stated that he considers the reunification of Ukraine with Russia a strategic goal and called the preservation of an independent Ukraine a threat to Russia, claiming that an independent Ukraine will inevitably become a springboard for the “collective West.” Medvedchuk's statements imply that Medvedchuk does not see himself as the future president of an independent Ukraine, but merely as the leader of his Other Ukraine organization – a Russian organization conducting the explicit Russification of Ukraine. Medvedchuk's statements indicate that the Kremlin seeks to absorb all of Ukraine into Russia, not just the four oblasts that Russia has illegally annexed. Russian Security Council Deputy Chairperson Dmitry Medvedev has repeatedly promoted Russia's far-reaching territorial objectives involving the absorption of nearly all of Ukraine into Russia.[21]

Medvedchuk and other Russian officials are attempting to position him and his organization, Other Ukraine, as responsible for the absorption of Ukraine into Russia and the complete destruction of an independent Ukrainian political and cultural identity. Medvedchuk boasted about the success of forced integration efforts and continued to advance the false Russian narrative that Ukrainians want to be Russified.[22] Medvedchuk continued to promote the Other Ukraine organization that he created in January 2023 as a mechanism for Russification efforts through the claim that the organization has created six centers to ”assist“ former Ukrainian citizens in Russia.[23] Medvedchuk stated that he has repeatedly met with Russian State Duma Chairperson Vyacheslav Volodin to advance cooperation between the Other Ukraine organization and State Duma committees.[24] Medvedchuk stated that Volodin issued an order to include representatives of Other Ukraine in working committees and commissions of state duma committees. Medvedchuk's claims, not yet substantiated by other Russian officials, are an attempt to elevate Medvedchuk and his Other Ukraine project to the status of leaders of the Kremlin's project to Russify Ukraine.

Russian forces continue to encourage war crimes against Ukrainian servicemembers and civilians on the battlefield. Far-right Russian paramilitary unit Rusich Sabotage Assault Reconnaissance Group leader Alexei Milchakov amplified photos of the November 15 execution of three Ukrainian prisoners-of-war (POWs) and claimed that he would offer cash prizes to the first three people who submit a photo with “clearly executed prisoners in the background.”[25] Milchakov operates as both the leader of a Russian paramilitary unit and a prominent voice in the Russian milblogger information space, and his calls to commit war crimes against Ukrainian servicemembers reflect Russian forces’ widely accepted cultural and systemic practice of committing war crimes on the battlefield.

The Ukrainian Zaporizhia Oblast Prosecutor's Office reported on November 16 that it opened an investigation into Russian forces’ November 14 execution of three Ukrainian POWs in the Hulyaipole direction.[26] A source reportedly affiliated with Ukrainian military intelligence posted footage on November 15 showing Russian forces murdering two surrendering Ukrainian POWs on the outskirts of Zatyshshya (east of Hulyaipole).[27] A returned Ukrainian civilian whom Russian occupation authorities detained in occupied Donetsk Oblast in 2020 told Ukrainian outlet Suspilne that Russian occupation authorities brutally tortured him.[28] ISW continues to assess that the Russian military command is endorsing and sometimes ordering war crimes on the battlefield and that Russia is torturing and abusing Ukrainian civilian prisoners.[29]

https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-november-16-2025/

22,131 posted on 11/17/2025 12:09:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22091 | View Replies]

Day 1,361 of the Muscovian invasion. 1,160 [average is 851] i.e. more than 48 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 45% above average


22,132 posted on 11/17/2025 12:12:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22092 | View Replies]

To: BeauBo
🤬🇰🇵 Russia is involving North Korean soldiers in mine clearance in the Kursk region, — Reuters.

North Korea's participation in mine clearance on Russian territory highlights both countries’ intention to deepen their military cooperation.

https://bsky.app/profile/theukrainianreview.bsky.social/post/3m5rkx4uhik2b

22,133 posted on 11/17/2025 12:39:21 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22132 | View Replies]

To: blitz128
Russian spy drones owned the sky—until Ukraine took the fight underground. Our exclusive from inside the bunkers where anti-aircraft teams hunt Russia's high-altitude reconnaiance drones.

Big Russian reconnaissance drones like the Orlan-10, Zala, and Supercam slip through Ukrainian defenses and patrol for hours deep in Ukrainian territory, guiding Iskander missiles and Lancet drones to devastate Ukrainian training grounds, logistical hubs, and civilian targets. Until recently, Ukraine was powerless against these spy drones. Flying at altitudes of 4-5 km, above the range of MANPADs and anti-aircraft guns, demanding expensive anti-air missiles, the feared recon UAVs could loiter for hours, unhindered, spotting targets that Russian ballistic missiles would slam into minutes later.

Even if the Russian scouts got into range, Ukraine's air defense teams were prohibited from attempting to shoot them down during the day, lest they themselves become a target. Then came Ukraine's $600 interceptor drones—now hunting the $30,000-120,000 reconnaissance UAVs from underground bunkers the Russians can't target.

https://euromaidanpress.com/2025/10/31/you-cant-hunt-spy-drones-from-underground-except-ukraine-does-and-its-working/

22,134 posted on 11/17/2025 12:44:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22133 | View Replies]

To: FtrPilot
Something is up! 137 trucks were recorded for the first time at Engels-2 airbase. — TG “Strategic Aviation RF”

Tu-95s from Ukrainka (far East) and Olenya are flying into Engels, loading up, and staying put or cycling back to Olenya while keeping themselves inside strike range of Ukraine.

https://bsky.app/profile/urikikaski.bsky.social/post/3m5ro5wmf7m2a

22,135 posted on 11/17/2025 12:58:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22134 | View Replies]

To: LowIQ; clown
🍈

😂😂😂😂

More good news from Jay in Kyiv

FYI, Jay has a BlueSky account.


22,136 posted on 11/17/2025 3:51:30 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22118 | View Replies]

To: AdmSmith
AdmSmith with some Morning BlueSky


22,137 posted on 11/17/2025 3:54:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 22135 | View Replies]

To: dennisw

Will be very interesting winter in Russia. Western Russia has, for the most part, been unaffected by pitin’s war. That is changing🤔


22,138 posted on 11/17/2025 4:04:51 AM PST by blitz128
[ Post Reply | Private Reply | To 22119 | View Replies]

To: AdmSmith; marcusmaximus

“Tu-95s from Ukrainka (far East) and Olenya are flying into Engels, loading up, and staying put or cycling back to Olenya while keeping themselves inside strike range of Ukraine.”

My guess would be that they are preparing for another big wave attack on Ukraine’s civilian energy infrastructure.


22,139 posted on 11/17/2025 4:06:00 AM PST by BeauBo
[ Post Reply | Private Reply | To 22135 | View Replies]

To: BeauBo

lol blue sky is the problem?
Not lack of ammunition, equipment (mad max attacks)food, fuel, revenue, poor pitinistas it is really getting hard for them 😂

What AD doink?😂😂


22,140 posted on 11/17/2025 4:51:35 AM PST by blitz128
[ Post Reply | Private Reply | To 22139 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 22,081-22,10022,101-22,12022,121-22,14022,141-22,155 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson