Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 21,441-21,46021,461-21,48021,481-21,50021,501-21,509 last
To: gleeaikin

“Correction, Cuchoo Program, Alexandr Dugin copied from a Nazi breeding the perfect Aryans program.”

Nothing wrong with a breeding program, just so long as you are not out killing off those who not up to snuff. Which the Nazis did. Hitler copied Margaret Sanger and similar people.

The US breeding program is dysgenic, and done via government welfare payments. Where we get the clowns and dumbass breeding more than normies and the hi-IQs. Here we have white girls and women permanently diluting the white gene pool by mud sharking. The stone cold truth is that non whites always want some cream in their coffee, with certain Asians excepted. Such as Japanese.


21,501 posted on 11/02/2025 9:19:34 PM PST by dennisw (There is no limit to human stupidity )
[ Post Reply | Private Reply | To 21499 | View Replies]

To: gleeaikin

“If the Ukrainians really want to mess up Russia’s winter oil production and transport, I guess they will want to bomb the propylene glycol producing plants.”

Few weeks ago the Ukies took out a very large petro-chemical complex.>>>>>>>>

“there are credible reports that Gazprom Neftekhim Salavat (a major petrochemical/oil complex in Russia’s Bashkortostan region) was hit by Ukrainian-drone strikes in recent weeks.”


21,502 posted on 11/02/2025 9:26:13 PM PST by dennisw (There is no limit to human stupidity )
[ Post Reply | Private Reply | To 21498 | View Replies]

To: gleeaikin

21,503 posted on 11/02/2025 9:26:39 PM PST by dennisw (There is no limit to human stupidity )
[ Post Reply | Private Reply | To 21498 | View Replies]

To: BeauBo

Many Russian nuke have not been maintained, so that they will not explode. (Nukes need tritium to be refreshed. It decays fast.) >>> “However, tritium is radioactive and has a short half-life of approximately 12.3 years, meaning it decays and loses its ability to sustain nuclear fusion. This necessitates the continuous replenishment of tritium in nuclear weapons to maintain their effectiveness.”

WHILE>>>

Many far north oil infrastructure are not being maintained, so that they will explode. From the 7% water content in Urals crude, freezing.


21,504 posted on 11/02/2025 9:39:14 PM PST by dennisw (There is no limit to human stupidity )
[ Post Reply | Private Reply | To 21494 | View Replies]

To: dennisw

Maybe the components installed by the Western companies in the post Soviet rebuild will bear the cold better. Let’s find out the hard way…


21,505 posted on 11/02/2025 11:35:06 PM PST by BeauBo
[ Post Reply | Private Reply | To 21500 | View Replies]

To: PIF; Beau; blitz128; gleeaikin
Russian Offensive Campaign Assessment, November 2, 2025

Russian forces continue to intensify offensive operations in and around Pokrovsk to seize the town and collapse the Ukrainian pocket. Both Ukrainian and Russian forces recently made tactical advances in the Pokrovsk area. Geolocated footage published on November 1 indicates that Russian forces recently advanced in southeastern Pokrovsk.[1] Additional geolocated footage published on November 2 shows Ukrainian forces striking two Russian soldiers in northern Pokrovsk conducting what ISW assesses was an infiltration mission that did not change the control of terrain or the forward edge of the battle area (FEBA).[2] Ukrainian military sources and Russian milbloggers recently stated that Russian forces are infiltrating into northern Pokrovsk.[3] Russian milbloggers claimed that Russian forces advanced in northeastern, central, and southern Pokrovsk; in northern and southeastern Myrnohrad; and south of Hnativka and Rih (all east of Pokrovsk).[4] A Russian milblogger reported that Ukrainian forces recaptured territory north of Zatyshok (northeast of Pokrovsk).[5] The Ukrainian General Staff reported on November 2 that Ukrainian forces recaptured 400 square meters in an unspecified area of the Pokrovsk direction, likely referring to recent tactical counterattacks north and northwest of Pokrovsk.[6]

Russian forces have likely deprioritized offensive operations in the Kostyantynivka-Druzhkivka tactical area in favor of completing the seizure of Pokrovsk and Myrnohrad. Russian assault tactics in the Pokrovsk direction are resulting in high casualty rates. A Ukrainian non-commissioned officer (NCO) operating in the Pokrovsk direction recently reported that Russian forces have decreased the intensity of assaults in the Kostyantynivka direction following a failed mechanized assault on October 27, and a Russian milblogger assessed on November 1 that Russia will likely prioritize seizing Pokrovsk and Myrnohrad before renewing significant efforts to seize Kostyantynivka.[7] The commander of a Ukrainian battalion operating in the Pokrovsk direction stated on November 1 that Russian assault units search for routes to bypass Ukrainian strongpoints in Pokrovsk and infiltrate into the Ukrainian near-rear while other Russian units — likely drone or artillery crews or lesser-quality infantry — work to destroy the Ukrainian strongpoint.[8] The commander stated that Russian forces send untrained soldiers on assaults to draw Ukrainian drone and artillery fire, revealing the positions of Ukrainian drone and artillery crews, after which trained Russian assault infantry attempt to engage these Ukrainian crews in close combat. The commander stated that Russian forces regularly attack along the same routes, resulting in heavy casualties. The commander stated that Russian forces are constantly committing new units to battle and sending reinforcements to the area. A Ukrainian military-focused Telegram channel published images showing high concentrations of Russian casualties near Rodynske (north of Pokrovsk) and attributed the high casualty rate to Ukrainian drone strikes.[9] The spokesperson of a Ukrainian brigade operating in the Pokrovsk direction reported on November 2 that elements of the Russian 155th Naval Infantry Brigade (Pacific Fleet) sustained such heavy personnel losses that they are now combat ineffective and withdrawing, and that elements of the 108th Motorized Rifle Regiment and 68th Tank Regiment (both 150th Motorized Rifle Division, 8th Combined Arms Arm [CAA], Southern Military District [SMD]) are replacing them.[10] The Atesh Crimea-based Ukrainian partisan group reported on November 1, citing sources in the brigade, that elements of the Russian 74th Motorized Rifle Brigade (41st CAA, Central Military District [CMD]) are suffering heavy casualties and high rates of desertion.[11] The Atesh group noted that the brigade is getting no rest and not evacuating wounded from the battlefield, which both contribute to the high casualty rate.

Ukrainian forces struck oil and electrical infrastructure in Russia on the night of November 1 to 2. The Ukrainian General Staff reported on November 2 that Ukrainian forces struck the Tuapse oil terminal and its surrounding infrastructure in Krasnodar Krai overnight, and geolocated footage published on November 1 shows fires burning at the port's berth complex and an oil tanker moored at the port.[12] Sources in Ukraine's Security Service told Ukrainian outlet Suspilne that the strikes caused a fire on an oil tanker, disabled four berths, and damaged buildings at the port.[13] Ukrainian Navy Spokesperson Captain Third Rank Dmytro Pletenchuk stated that at least three Russian shadow fleet tankers were moored at the Tuapse terminal at the time of the strike and noted that the port accounts for 20 percent of Russia's crude oil exports.[14] Krasnodar Krai regional authorities claimed that drone debris damaged a tanker and an oil terminal in Tuapse and caused a fire.[15] Russian state oil company Rosneft stated that the Tuapse oil terminal processes about 17 million tons per year, and the terminal mainly exports petroleum products from Rosneft’s Tuapse, Achinsk, and Samara refineries and transships third-party resources.[16]

Ukrainian Center for Countering Disinformation Head Lieutenant Andriy Kovalenko, who frequently reports on successful Ukrainian strikes, implied on November 2 that Ukrainian strikes caused fires at substations in Kursk and Lipetsk oblasts and a thermal power plant in Oryol Oblast.[17] Ukrainian Unmanned Systems Forces (USF) Commander Major Robert “Magyar” Brovdi reported on November 2 that USF and Ukrainian Special Operations Forces (SSO) struck five substations, including near Gryazi, Lipetsk Oblast, on the night of November 1 to 2.[18]

Belgian officials reported unidentified drone incursions near the Kleine Brogel Air Base in Belgium from October 31 to November 2. Belgian Defense Minister Theo Francken reported on November 2 that there were three reports of large drones flying at higher-than-typical altitudes above the Kleine Brogel Air Base on the night of November 1 to 2.[19] Francken stated that the drones were clearly conducting a mission involving Kleine Brogel Air Base and that Belgian forces unsuccessfully attempted to jam and intercept down the drone. Belgian authorities also investigated reports of drones near Kline Brogel Airbase on the night of October 31 to November 1.[20] Belgian media noted that Kleine Borgel Air Base will host F-35 fighter jets in 2027.[21]

Russian authorities continued attempts to shut down Russian insider source VChK-OGPU as part of a crackdown on social media sources that share insider information about the Kremlin and Russian security services. Russian insider channel VChK-OGPU stated on its website that Russian authorities instructed Telegram administrators to remove its reserve Telegram accounts, VChK-OGPU-Info and VChK-OGPU-Info2, on November 2 after instructing Telegram to remove VChK-OGPU's main account and arresting one of the channel's authors on November 1.[22] The Kremlin likely targeted VChK-OGPU as part of a wider effort to cleanse the Russian information space of sources that publish information that the Kremlin deems threatening to the regime's stability.

https://understandingwar.org/research/russia-ukraine/russian-offensive-campaign-assessment-november-2-2025/

VChK-OGPU site:
https://www.rucriminal.info/en

21,506 posted on 11/03/2025 12:48:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21452 | View Replies]

Day 1,346 of the Muscovian invasion. 1,60 [average is 850/day], i.e. more than 48 Russians, Norks and Cubans/h. Vehicles and fuel tanks more than 145% above average
Correction: Artillery is +45 total is 34207
Troop loss 7-day average rises to 1020
Tanks, Artillery, UAVs and Vehicles are above averages
Another +2 Special Equipment is nice



21,507 posted on 11/03/2025 1:13:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21454 | View Replies]

To: dennisw; gleeaikin; blitz128

And here - CLOWN denny - offers us a glimpse of Ukranian racism


Navigation: use the links below to view more comments.
first previous 1-50 ... 21,351-21,40021,401-21,45021,451-21,50021,501-21,507 last
To: gleeaikin

“Correction, Cuchoo Program, Alexandr Dugin copied from a Nazi breeding the perfect Aryans program.”

Nothing wrong with a breeding program, just so long as you are not out killing off those who not up to snuff. Which the Nazis did. Hitler copied Margaret Sanger and similar people.

The US breeding program is dysgenic, and done via government welfare payments. Where we get the clowns and dumbass breeding more than normies and the hi-IQs. Here we have white girls and women permanently diluting the white gene pool by mud sharking. The stone cold truth is that non whites always want some cream in their coffee, with certain Asians excepted. Such as Japanese.

21,501 posted on 11/02/2025 9:19:34 PM PST by dennisw (There is no limit to human stupidity )

21,508 posted on 11/03/2025 3:20:49 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 21501 | View Replies]

To: BeauBo

Regardless of any anti freeze measures that are available and working, the oil has to move.
If there is no place for the oil to go, or the infrastructure is damaged to the point where the oil can’t be moved in the volumes needed there will be damage.

Pipelines are not meant to be for storage.

Likely any damage will compound problems further up and down the chain


21,509 posted on 11/03/2025 4:19:10 AM PST by blitz128
[ Post Reply | Private Reply | To 21488 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 21,441-21,46021,461-21,48021,481-21,50021,501-21,509 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson