Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 18,501-18,52018,521-18,54018,541-18,56018,561-18,576 next last
To: BroJoeK; FtrPilot; BeauBo
Told you so


18,541 posted on 07/23/2025 2:41:45 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18540 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, July 22, 2025

Ukrainian and Russian delegations will meet on July 23 in Istanbul for the third round of bilateral negotiations, but Kremlin officials are already dismissing and undermining the upcoming talks. Ukrainian President Volodymyr Zelensky announced on July 21 that Russian and Ukrainian representatives will meet in Istanbul for the next round of peace negotiations on July 23.[11] Zelensky stated that Ukraine's National Security and Defense Council Secretary Rustem Umerov will again lead the Ukrainian delegation, which will also include representatives from Ukrainian intelligence, the Ministry of Foreign Affairs, and the Office of the President.[12] Zelensky noted that the Ukrainian delegation will focus on returning prisoners of war (POW) and deported Ukrainian children and announced that Russian and Ukrainian representatives have already begun discussing additional POW exchanges.[13] Kremlin Spokesperson Dmitry Peskov stated that “there is no reason to count on any breakthroughs” in the upcoming talks and that emphasized that Russia intends to ensure its interests and fulfill the tasks that the Kremlin has set from the start of the war - likely referring to Russia's original war aims, such as regime change in Ukraine, changes to the North Atlantic Treaty Organization's (NATO) open-door policy, and the reduction of Ukraine's military such that it cannot defend itself.[14] Peskov stated that the Ukrainian and Russian delegations will need to discuss the draft memoranda that they exchanged during the second round of talks on June 2. Russia's delay in exchanging its memorandum until the June 2 meeting and Peskov’s July 22 statements continue to indicate that Russia is deliberately trying to delay the negotiation process in order to protract the war and make additional gains on the battlefield.[15]

Russia's reported long-term rearmament plans further indicate that the Kremlin is preparing for a potential future conflict with NATO. Ukraine's Main Military Intelligence Directorate (GUR) Head Lieutenant General Kyrylo Budanov stated on July 22 that Russia plans to spend $1.1 trillion on rearmament by 2036 (or roughly $110 billion per year over the next ten years).[16] Budanov stated that Russia is further mobilizing its society and economy in preparation for a future large-scale war. Budanov noted that Russia's restoration of the Moscow and Leningrad military districts (MMD/LMD) and ongoing efforts to form new divisions based on existing units and formations are indicative of Russia's long-term plans. ISW has long assessed that Russia's restoration of the MMD and LMD and ongoing efforts to restructure and expand the Russian Armed Forces are in preparation for a future large-scale conventional war against NATO.[17] Russian President Vladimir Putin recently claimed that Russia's 2025 military budget is 13.5 trillion rubles (roughly $172 billion) and that Russia plans to steadily decrease defense spending beginning in 2026.[18] It is unclear exactly how much Russia spends on military and defense industrial procurement, however, given ongoing Kremlin efforts to obscure its national budget from domestic and foreign audiences. It remains unclear exactly how Russia will spend and allocate this reported rearmament fund, and the Kremlin may view Russia's rearmament as a separate budget line from Russia's yearly military budget for Ukraine.

Russian authorities recently detained Bryansk Oblast Vice Governor Nikolai Simonenko and former Belgorod Oblast Vice Governor Rustem Zainullin, likely as part of the Kremlin's continued efforts to scapegoat local officials for larger Russian border security failures following Ukraine's August 2024 Kursk Oblast incursion. Russian law enforcement officials told Kremlin newswire TASS on July 22 that Russian authorities detained Simonenko on abuse of power charges and searched Simonenko’s home and workplace as part of a larger criminal case investigating the embezzlement of funds allocated for the construction of defensive fortifications in Bryansk Oblast border areas.[19] Russian authorities similarly detained Zainullin for fraud on June 21 on suspicion of embezzling 32 million rubles (roughly $408,000) in funds allocated to constructing defensive fortifications in the Belgorod Oblast border area.[20] Russian authorities previously detained former Kursk Oblast Governor Alexei Smirnov on similar embezzlement charges in what ISW assessed to be a concerted Kremlin effort to use Kursk Oblast officials as scapegoats for Russia's failure to repel the Ukrainian incursion into Kursk Oblast.[21] Russian President Vladimir Putin also notably dismissed Russian Minister of Transport and former Kursk Oblast Governor Roman Starovoit on July 7 just prior to Starovoit’s reported suicide.[22]

Russian authorities targeted a Telegram channel that revealed Russia's role in the late December 2024 downing of an Azerbaijan Airlines plane as part of a wider campaign to censor Telegram channels that are critical of the Kremlin. Russian authorities conducted a raid on July 22 against the offices of Baza, a Telegram channel reportedly affiliated with Russian law enforcement, as part of an abuse of power investigation against Russian police officers who allegedly disclosed sensitive information to Baza.[23] Russian authorities reportedly held Baza editor-in-chief Gleb Trifonov and other Baza journalists for questioning, and the Russian Investigative Committee claimed that it detained Trifonov and a colleague on suspicions of bribery.[24] in January 2025, Baza published a transcript of a conversation between the pilots and ground controllers during the December 2024 downing of the Azerbaijan Airlines plane, disclosing that Russian authorities did not allow the plane to land in Russia even after the plane's crew requested an emergency landing.[25] The Kremlin's raid on Baza offices occurred after several smaller-scale incidents in recent weeks, including an Azerbaijani raid on the offices of Russian state-owned Sputnik propaganda outlet in Baku, which have inflamed Azerbaijani-Russian relations after Russian President Vladimir Putin refused to take responsibility for Russia's role in downing the plane.[26] Russian officials have been engaged in efforts throughout the war to censor critical Telegram channels and are likely using the investigation into police misconduct as a means of censoring and punishing Baza for its role in increasing tensions between Azerbaijan and Russia.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-july-22-2025

18,542 posted on 07/23/2025 6:17:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18526 | View Replies]


18,543 posted on 07/23/2025 6:26:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18463 | View Replies]

Day 1,244 of the Muscovian invasion. 970 [average is 840/day], i.e. more than 45 Russians and Norks/h. Vehicles and fuel tanks more than 70% and artillery more than 70% above average. Motorcycles are not counted yet.


18,544 posted on 07/23/2025 6:27:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18527 | View Replies]

To: FtrPilot
"Who He?"


18,545 posted on 07/23/2025 6:40:35 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18544 | View Replies]

To: JonPreston
(R)
18,546 posted on 07/23/2025 6:40:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18545 | View Replies]

To: JonPreston

18,547 posted on 07/23/2025 6:41:17 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18546 | View Replies]

To: JonPreston

18,548 posted on 07/23/2025 6:41:40 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18547 | View Replies]

To: JonPreston
It is a good sign that the Su- 24s and Su-25s are gone, and they are starting to dig into their last line of defense, their Su-57s.

Let’s have them shot down anyway, so they aren’t used to bully much weaker neighbors.

Besides, Russia needs a significant emotional experience to deter them from aggression. Their nose must be rubbed in it, so that they lose their taste for blood.

Send more Air Defense Artillery!


18,549 posted on 07/23/2025 6:42:04 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18548 | View Replies]

To: mir
🍈

😂😂😂😂

🤡


18,550 posted on 07/23/2025 6:42:37 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18549 | View Replies]

To: JonPreston
🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )

18,551 posted on 07/23/2025 6:42:56 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18550 | View Replies]

To: BeauBo
The Chinese are massively counterfeiting Russian brands of auto parts.

In 2024, there were no such cases at all, and in the first quarter of 2025 alone, the number of counterfeits on the market increased by 20%. Most often, brake pads, filters, technical fluids and brushes are counterfeited. Such counterfeit products occupy the first lines of search engine results. The brands Arnezi, Ganz, Avtoprestige, Sibiria Auto, Tekhnoprofil and Voltazh have already fallen victim to copying.

https://t.me/bankrollo/45556

18,552 posted on 07/23/2025 6:44:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18531 | View Replies]

Because of his stubbornness, #Zelensky has pushed #Ukraine️ back 50 years. Now the people of Ukraine will never elect a fool.
The President of Ukraine is not capable of taking decisions. He has no right to remain President or to throw the people of Ukraine in front of the…

pic.twitter.com/71sTdMg4wA— S.S. Chauhan RFS. (@SUBHAMSINGH112) July 22, 2025


18,553 posted on 07/23/2025 7:07:49 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18551 | View Replies]

To: AdmSmith

“The Chinese are massively counterfeiting Russian brands”

Russia’s economy under attack. De-industrialization is the goal.

Then they will have to sell the land for trinkets.

Putin has been the Doom of Russia.


18,554 posted on 07/23/2025 7:12:30 AM PDT by BeauBo
[ Post Reply | Private Reply | To 18552 | View Replies]

To: BeauBo

Have believed for years the big winner in this will be China, using pitin’s playbook of “historical ownership”, pitin can say goodbye to eastern part of federation. Why buy the milk when you can own the cow.

Pitin remains the supreme strategist 😎😂


18,555 posted on 07/23/2025 7:38:55 AM PDT by blitz128
[ Post Reply | Private Reply | To 18554 | View Replies]

Didn't you call Zelensky "Young Churchill"?

Ukrainian protestors chant:

- We are not idiots
- Yermak should F off
- Zelensky is the devil

pic.twitter.com/dUhcr72Sif— Lord Bebo (@MyLordBebo) July 23, 2025


18,556 posted on 07/23/2025 7:48:36 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 18555 | View Replies]

To: blitz128

🍈 still flailing, and I am enjoying every moment


18,557 posted on 07/23/2025 10:13:34 AM PDT by blitz128
[ Post Reply | Private Reply | To 18555 | View Replies]

To: blitz128; BeauBo; ETCM
The US has approved the sale of equipment to Ukraine for the repair of Bradley infantry fighting vehicles, as well as HAWK Phase III air defense systems, worth $322 million, - the Pentagon.

https://x.com/Heroiam_Slava/status/1948105237543194936


18,558 posted on 07/23/2025 1:56:46 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 18557 | View Replies]

To: PIF
YOBLYKS OF THE DAY 🤩

🔥Powerful work of the 🇺🇦 414th UAV Brigade «Birds of Magyar»

https://x.com/GloOouD/status/1948078987571245541


18,559 posted on 07/23/2025 1:59:26 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 18558 | View Replies]

DARWIN AWARD WINNER: American Derek Huffman fled with his family to Russia to escape the ‘corrupt’ West. Domiciled in Putin’s “American Village’, he was promised a job with the Russian army as a welder. Huffman is reported to have been killed in combat in Ukraine.

https://x.com/ChuckPfarrer/status/1948031949987348502


18,560 posted on 07/23/2025 2:03:07 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 18559 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 18,501-18,52018,521-18,54018,541-18,56018,561-18,576 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson