Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,361-16,38016,381-16,40016,401-16,420 ... 20,241-20,258 next last
To: FtrPilot
Ukraine attacks elite Russian unit base nearly 7,000km away in Vladivostok, source claims

Ukraine's military intelligence agency (HUR) was behind explosions near Desantnaya Bay in Russia's Vladivostok on May 30, which reportedly damaged military personnel and equipment, a source in HUR told the Kyiv Independent.

If confirmed, the Vladivostok operation would be Ukraine's furthest incursion into Russian territory - approximately 6,800 kilometres from the Ukrainian border. According to the source, two blasts occurred early in the morning at a site where Russia's 47th Separate Air Assault Battalion of the 155th Separate Guards Marine Brigade was stationed. The 155th Marine Brigade has been actively involved in the full-scale invasion of Ukraine, including battles in Mariupol and Vuhledar in Donetsk Oblast, as well as operations in Russia's Kursk Oblast.

Local media reported two loud bangs, followed by temporary road closures and emergency vehicles seen in the area, but did not mention anything about a military base.

Russia's Anti-Terrorist Commission of Primorsky Krai attributed the explosions to the ignition of propane-butane cylinders inside a vehicle. No official casualties have been reported.

One of the explosions allegedly happened near a checkpoint, while the other hit the location of personnel and the unit's command. “Manpower, military equipment, and special equipment were hit,” the source claimed. The Kyiv Independent could not verify these claims. Desantnaya Bay is located in Vladivostok in Russia's Far East, which lies some 185 kilometres (114 miles) from the Russian-North Korean border.

https://kyivindependent.com/ukraine-behind-explosions-in-vladivostok-causing-damage-to-russian-military-source-claims/

16,381 posted on 05/31/2025 9:47:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16380 | View Replies]

To: AdmSmith

16,382 posted on 05/31/2025 11:01:51 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16381 | View Replies]

Neocons in Motion

NO PEACE!

Pompeo in Odessa …

pic.twitter.com/Ulvg8UBuGa— Lord Bebo (@MyLordBebo) May 31, 2025


16,383 posted on 05/31/2025 11:09:38 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16382 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Hidden Bear: The GRU hackers of Russia's most notorious kill squad





Russian GRU Unit 29155 is best known for its long list of murder and sabotage ops, which include the Salisbury poisonings in England, arms depot explosions in Czechia, and an attempted coup d’etat in Montenegro. But its activities in cyberspace remained in the shadows — until now. After reviewing a trove of hidden data, The Insider can report that the Kremlin's most notorious black ops squad also fielded a team of hackers — one that attempted to destabilize Ukraine in the months before Russia's full-scale invasion.

xxx

The Fifth Service of Russia's domestic security agency, or FSB, is widely understood to have been the main Russian intelligence organ tasked with destabilizing Ukraine in advance of the February 2022 invasion. And indeed, on December 1, 2021, and January 25, 2022, there were reports that coup attempts — likely backed by Moscow — were in the works. Now, new evidence shows that GRU Unit 29155 was involved in similar efforts, pioneering tactics in Ukraine it is now employing on a much broader scale in its escalating “shadow war” against the West.

In August 2021, five months before Russia's full-scale invasion, Unit 29155’s hackers attempted to exacerbate a rift between Ukraine's nationalist groups and the Zelensky administration. Soldiers from many of Kyiv’s most effective units, which had been fighting off Russian forces in the Donbas since 2014, were less than enthusiastic about their president. In 2019, a visit by Zelensky to the front lines resulted in an on-camera argument between the head of state and members of the Azov Battalion. In 2021, Zelensky was still politically vulnerable to protest and pressure from nationalist elements in Ukraine, including those opposed to his campaign pledge to end the war in the east by making concessions to the Kremlin.

Adhering to the familiar formula of false-flag operations, Stigal recruited dozens of low-level assets to impersonate members of the Azov Battalion – one of Ukraine's best paramilitary outfits, but also a group that had faced scrutiny in the West over the right-wing tendencies of some of its members. He went further and engaged with at least two top commanders in Azov, impersonating a leader of the Chechen dissident Ichkeria organization, which is opposed to Chechnya's warlord-president Ramzan Kadyrov, and offering them an alliance against Zelensky. Duped by Stigal, at least one of the Azov commanders accepted the offer of help.

xxx

The hackers searched for vulnerabilities in government agencies and critical infrastructure sites in Uzbekistan, Georgia, Czechia, Slovakia, Estonia, Poland, Moldova, and Armenia, the Aegaeon logs show. Of the hundred or so known targets of Unit 29155, a third were in Czechia, where operatives from the same GRU unit blew up two Ministry of Defense-owned ammunition warehouses in Moravia in 2014. The majority of requests from the servers are from 2021 and 2022, after which the hacking either significantly decreased or Unit 29155 simply discarded the Aegaeon server in favor of others.

Among the phones that the hackers checked for call records and metadata were not only the objects of their professional interest, but those of acquaintances and relatives. One target was Zhana Barskaya, the mistress of Unit 29155 commander Andrey Averyanov. Judging by the phone numbers they were interested in, it is clear that the hackers were also avid readers of this publication.

When The Insider published a story in January of this year about Unit 29155 suborning Afghan couriers to pay Taliban militants to attack U.S. and coalition forces in Afghanistan, the hackers scanned the number of Ivan Senin, one of the directors of the bounty program, within 24 hours of the article's release.

https://theins.press/en/inv/281731

16,384 posted on 05/31/2025 12:01:59 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16381 | View Replies]

As a service to ... The article above in Russian: Мошенники, убийцы, студенты: из кого ГРУ собрало команду хакеров-провокаторов и почему она провалилась https://theins.press/inv/281701


16,385 posted on 05/31/2025 12:05:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16384 | View Replies]

To: AdmSmith

Bone-Crushing Sanctions bill (SB 1241) to advance in the US Senate. With 81 Senators signed on as co-sponsors, it has a filibuster-proof, and veto-proof majority. Putin’s criminality has engendered huge opposition to Russia, around the world.

Kyiv Independent:

“The U.S. Senate is expected to “start moving” next week on a bill introducing sweeping new sanctions against Russia, Republican Senator Lindsey Graham said at a press briefing in Kyiv on May 30 attended by The Kyiv Independent.

The proposed bill would impose 500% tariffs on imports from countries purchasing Russian oil, gas, uranium, and other products. At least 82 U.S. senators are prepared to vote for the bill, Graham said.

“I would expect next week that the Senate will start moving the sanctions bill,” Graham, a vocal supporter of Ukraine and close ally of U.S. President Donald Trump, said. “There are House members that are ready to move in the House, and you’ll see congressional action. President Trump said that the next two-week period will be outcome-determined.”

Asked whether Congress would pass the bill before its summer recess and whether Trump would sign it, Graham responded: “I’ve never been more optimistic than I am today.””


16,386 posted on 05/31/2025 1:30:57 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16385 | View Replies]

To: AdmSmith; PIF

Global preparations for Bone-Crushing Sanctions on Russia continue apace.

OPEC+ just announced their third consecutive monthly output increase, over Russian objections.

Production is rising, demand is weak, and inventories are rising. The market is getting better and better prepared, for competitors to swoop in and take away all of Russia’s oil export market share, in a once in a lifetime realignment, courtesy of Putin’s historic mismanagement.

These three months of OPEC+ production rises inject enough new supply to replace over 1/3 of Russia’s current exports, but some of it is building up in inventory, to further buffer the shock of a sudden cutoff of Russian supply. Other significant new non-OPEC+ production is also slated to come online in the coming months as well, such as Guyana.

And of course, OPEC+ producers have additional slack capacity that can be activated, especially Saudi Arabia, which alone has enough surplus capacity to replace all of Russia’s current exports (although there would be some months lag time to bring it all into production). There is also US production, which could surge, along with the expected price bump.

I would expect that the Bone-Crushing Sanctions Bill would have an initial adjustment period before going into effect, perhaps sixty days, to allow the delivery of shipments already underway.

With the running start that competitive producers already have, and a couple of months more to throw off all the brakes, the oil markets should be well situated to pick up all of Russia’s current export market share - a devastating structural blow to Russia’s economy, and an historic windfall to other oil producers.

Kyiv Independent reports:

“OPEC+ will boost oil production by 411,000 barrels per day in July, marking the third consecutive monthly increase and reinforcing a major strategic shift that has driven crude prices to a four-year low.

Key producers, including Saudi Arabia, agreed to the supply hike during a virtual meeting on May 31, following similarly sized increases set for May and June, delegates familiar with the talks told Bloomberg.

The move continues to diverge from OPEC+’s longstanding approach of curbing output to maintain high oil prices. Russia, a major partner in the alliance, reportedly proposed pausing the increases but was overruled.”


16,387 posted on 05/31/2025 2:10:51 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16385 | View Replies]

To: BeauBo
Bone-Crushing Sanctions bill (SB 1241) to advance in the US Senate

Odds of Trump signing this, 0.00000000000000000000000000000000000000000001

16,388 posted on 05/31/2025 3:12:42 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16386 | View Replies]

To: JonPreston
European forces decided to act swiftly, following the newest EU sanctions package and detain an oil tanker from the Russian shadow fleet. In response to a planned boarding, Russian forces rapidly escalated the tensions by deploying their fighter jets to threaten the NATO ships from getting close.

A new wave of EU sanctions has directly targeted Russia’s notorious shadow fleet of oil tankers, which is used to bypass Western embargoes. As part of the EU’s 17th sanctions package, 149 vessels have been added to the blacklist for transporting Russian oil in violation of the price cap.

These mostly uninsured tankers will be barred from accessing EU ports and services, including insurance, repairs, and refueling. Among them, 25 were recently tracked in the Baltic and North Sea, where their presence also raises serious environmental and security concerns because of their poor condition.

European officials warn that these ships pose not only a pollution risk, but also a threat to vital undersea cables and energy infrastructure, due to several incidents with torn cables in the past.

Noting the Baltic Sea’s vulnerability to environmental disasters caused by oil spillage, due to its shallow and enclosed nature, the EU has prompted stricter sanctions on the aged and reckless ships of Russia’s shadow fleet.

As the EU prepares to expand the sanctions list to over 350 ships in total, it has also moved to authorize visa bans and asset freezes against shadow fleet captains. These measures aim to disrupt Russia’s illicit export routes and limit its wartime income.

Enforcement of the new package began immediately. A Gabon-flagged tanker under the name Jaguar, one of the newly sanctioned vessels, had previously anchored off a Russian port, prompting increased monitoring by NATO forces.

After approaching, the ship refused to identify itself and ignored orders from Estonia’s navy to halt and change course. Estonian patrol ships, helicopters, and patrol aircraft responded, with footage confirming the NATO response.

However, as NATO vessels prepared to board the Jaguar for inspection, the Russian Air Force dispatched a Su-35 fighter jet to the ship’s position in a show of force. According to Estonian defense officials, the Russian jet circled the tanker and signaled a clear intention to prevent any potential boarding or seizure.

Immediately, the planned boarding operation was called, as NATO captains and commanders assessed the risk of triggering a direct military clash as too high. An engagement involving NATO fighter jets or naval assets could have resulted in severe and far-reaching consequences. Estonia’s Foreign Minister confirmed that the aircraft briefly violated NATO airspace.

Finland and Lithuania both raised concerns about reckless Russian behavior, with Lithuania’s Prime Minister warning that Russia is clearly demonstrating a willingness to protect the route for its oil with all means, even risking a direct confrontation to protect its shadow oil fleet.

With conventional trade routes restricted due to Western sanctions, Russia relies heavily on this fleet of over 600 aging oil tankers to export crude oil to buyers from Asia.

These ships operate under obscure flags, are often uninsured, and are designed to operate below regulatory radar, making them critical to sustaining Russian state revenue, directly funding the war in Ukraine. Disruption of these flows would not only cripple Russia’s wartime economy, but also erode its global influence.

This incident shows how far Russia is willing to go to defend its economic lifelines, even deploying air assets to intimidate NATO ships. Yet, the imbalance in firepower is obvious. NATO F-35 squadrons routinely patrol the Baltic Sea. In a real engagement, a lone Russian fighter jet would have stood little chance. But, recognizing the risks, NATO wisely de-escalated to avoid a direct military engagement between Russia and NATO forces.

Overall, this standoff underscores the EU’s resolve to implement sanctions, which will only intensify. At the same time, Russia is desperate to protect its oil trade and take even higher risks.

With additional shadow fleet vessels likely to be sanctioned and better-armed naval patrols preparing future interception missions, Russia’s strategy of hiding its oil trade in plain sight is becoming increasingly untenable. The Jaguar may have escaped for now, but the message from Europe is clear: sanctions will not go unenforced.

https://www.youtube.com/watch?v=uWJvyIH5nFw

Romania remains on the side of the West, Freedom and Righteousness.

Kyiv Independent:

“Pro-EU candidate Nicusor Dan won the Romanian presidential election on May 18, defeating the far-right, anti-Ukraine George Simion.

With over 95% of the votes counted, Dan won Sunday’s runoff by a margin of 54.3% to Simion’s 45.7%, according to Romania’s election authority.

The result comes as a relief for Ukraine, who faced the loss of a key ally in the event of a Simion victory. Simion, leader of the Alliance for the Union of Romanians (AUR), championed a Euroskeptic platform that included ending military aid for Ukraine.

“Ukraine needs us, we don’t need Ukraine,” Simion said during a televised debate on May 8.

Simion is banned from entering both Ukraine and neighboring Molodova due to his anti-Ukrainian stance.

Dan, an independent centrist and the current mayor of Bucharest, supports aid to Ukraine, calling it “essential for the security of Romania.””

“Russia carried out its largest single drone attack since the start of its full-scale invasion, launching 273 drones overnight on May 18, Ukraine’s Air Force reported.

The attack comes just two days after Ukraine and Russia held their first direct peace talks since 2022, and one day ahead of a planned call between U.S. President Donald Trump and Russian President Vladimir Putin.”

Send more Artillery! (Time for the big guns)

Drop the bone-crushing sanctions bomb. Time to get the job done.

Putin won’t stop, he must be stopped.

President Trump has given him every chance to get out of his mess the easy way, but Putin has clearly chosen to go down with the ship (and take down his country with him).


16,389 posted on 05/31/2025 3:16:44 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15903 | View Replies]

To: JonPreston

“Odds of Trump signing this”

He was the first to propose this approach. Senator Graham just did the scut work of getting it typed up and staffed.

If Pootin doesn’t do as he is told, everything is being prepared to take away his oil revenue.

FAFO.


16,390 posted on 05/31/2025 3:23:36 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16388 | View Replies]

To: BeauBo

OilPrice.com reports:

(President Trump’s) “US representative to the United Nations told the UN Security Council on May 29 that the deal now on offer to end the war in Ukraine is the best possible outcome for Russia and that President Vladimir Putin should take it.

Prolonging the war is in no one’s interest, said John Kelley, acting US alternate representative to the UN, warning of the possibility that the United States would “consider stepping back” from its negotiation efforts if Russia “makes the wrong decision to continue this catastrophic war.”

Kelley added that additional sanctions on Russia are still on the table...

...US President Donald Trump warned on May 28 he would determine within “about two weeks” whether Putin is serious about ending the fighting.

“We’re going to find out whether or not he’s tapping us along or not, and if he is, we’ll respond a little bit differently. But it will take about a week and a half, two weeks,” Trump told reporters at the White House.”


16,391 posted on 05/31/2025 3:39:06 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16390 | View Replies]

To: BeauBo

"It's absurd when I come to Ukraine and people with ribbons in the colors of Bandera's flag hug me and thank me. I say we can't accept that, and they shrug their shoulders and ask: 'What do you mean? We will never agree with the fact that Bandera was declared a hero,'" said… pic.twitter.com/OhNNcp3qdC— Sprinter Observer (@SprinterObserve) May 30, 2025

"It's absurd when I come to Ukraine and people with ribbons in the colors of Bandera's flag hug me and thank me. I say we can't accept that, and they shrug their shoulders and ask: 'What do you mean? We will never agree with the fact that Bandera was declared a hero,'" said Polish President Andrzej Duda.

16,392 posted on 05/31/2025 4:40:04 PM PDT by scan_complete
[ Post Reply | Private Reply | To 16217 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, May 21, 2025

Russian officials’ public statements continue to demonstrate that Russia maintains wider territorial goals in Ukraine beyond the four oblasts that Russia has illegally declared as annexed. Russian State Duma Defense Committee Chairperson Andrei Kartapolov told Kremlin newswire TASS on May 31 that Ukraine risks losing Zaporizhzhia, Dnipro, Sumy, Kharkiv, Odesa, and Mykolaiv cities if Ukraine refuses a peace settlement and claimed that every day that Ukraine delays a diplomatic solution to the war worsens the conditions for Ukraine.[1] Russia may illegally declare Dnipropetrovsk, Sumy, Kharkiv, Odesa, and Mykolaiv oblasts annexed, especially should Russian forces launch offensive operations to seize these regional centers. Russia notably did not — and still does not — occupy Zaporizhzhia City when the Kremlin annexed Zaporizhia Oblast in September 2022. Kartapolov’s statement indicates that Russia maintains territorial ambitions beyond Luhansk, Donetsk, Zaporizhia, and Kherson oblasts — in line with Russian officials’ calls for Russia to seize Sumy City, claims that Kharkiv and Odesa cities are “Russian” cities, and increasing rhetoric about Russia's alleged historical ties to “Novorossiya” (which Russian officials have defined as all of eastern and southern Ukraine).[2] Kartopolov’s statement also indicates that the Kremlin continues to assess that Russian forces will be able to fight a protracted war against Ukraine to achieve these territorial goals and is not interested in good-faith negotiations to achieve a diplomatic settlement to the war. ISW continues to assess that Russian President Vladimir Putin holds a theory of victory that assumes that the Russian military will be able to continue gradual, creeping advances in Ukraine indefinitely.[3]

The Kremlin is continuing efforts to prepare Russian society and the Russian defense industry base (DIB) for a protracted war with Ukraine and potential future war with NATO. Russian President Vladimir Putin signed a decree on May 30 allowing the Russian government to revoke the rights of shareholders of defense industrial enterprises in the event that the enterprise fails to fulfill state defense orders during martial law.[4] The decree enables the Russian Ministry of Industry and Trade to appoint a management company to act as the sole executive body of the enterprise in order to fulfill contractual obligations to the Russian government. The decree applies to civilian aviation and shipbuilding companies, military development and production companies, and government subcontractors. Putin is likely setting legal conditions to allow the Russian government to commandeer elements of Russia's economy and DIB should the Kremlin introduce full martial law in order to transition the country to a full wartime footing. ISW continues to assess that the Kremlin is preparing Russian society and economy for a protracted war in Ukraine, indicating that Russia is not interested in engaging in good faith negotiations to reach a diplomatic settlement to its war in Ukraine.[5]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-31-2025

16,393 posted on 06/01/2025 12:03:05 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16368 | View Replies]

To: PIF; FtrPilot; BeauBo; blitz128; marcusmaximus
Day 1,193 of the Muscovian invasion. 1,230 [average is 827/day], i.e. more than 51 Russians and Norks/h. Vehicles and fuel tanks more than 200% and artillery more than 115% above average. Motorcycles are not counted yet



It takes 11,440 to make it 1,000,000.

16,394 posted on 06/01/2025 12:13:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16373 | View Replies]

To: blitz128; PIF; BeauBo
The Kremlin announced an assassination attempt on Putin in the Kursk region.

Кремлевская табакерка

The Kremlin has once again stated that an assassination attempt was being prepared against Putin in the Kursk region. And they have provided evidence.

We wrote (https://freerepublic.com/focus/bloggers/4219673/posts?page=16193#16193 ) : the recent landing of Vladimir Putin's helicopter in the epicenter of the repelling of an attack by enemy drones in the Kursk region, according to many in the Kremlin, was not accidental. A number of sources believe that it was an assassination attempt - the president was intended to be set up for drones or our air defense and killed by internal enemies who wanted the SVO to end as quickly as possible. The channel's interlocutors in the Presidential Administration say that they have new evidence to support this version.

This evidence is indirect, but “very weighty.” The day before, foreign agents wrote that there was no landing of Vladimir Vladimirovich's helicopter in the danger zone, the news about this was allegedly invented in the Kremlin. Кремлевская табакерка’s sources responded to this version. “The vile publications of foreign agents are further proof that internal enemies were not only preparing an assassination attempt on Vladimir Vladimirovich, but also decided to cover up their criminal plans. They are using enemy media for this. I hope that the security forces will sort out the situation and punish the guilty parties most severely. An assassination attempt is obvious here!” a high-ranking source in the Presidential Administration noted in this regard. Another source in the Kremlin agrees with him. And he indignantly stated: “Those who wanted to kill the president, in words, are for him. Many smile at him when they meet, fawn and publicly support his policies in every possible way. But they themselves dream and dream of the SVO ending as soon as possible. And for this sake they are ready to commit a terrible crime, I would even say, sacrilege.”

Representatives of the FSB, whom we asked to comment on these suspicions, replied that “certain signals have been received, checks are underway.” But so far they refuse to provide details.

https://t.me/kremlin_secrets/5739

Since several in the top echelons closest to Putin know that he will be overthrown when the war is over, they want this to happen in a planned manner, so that they have better control over what happens afterwards.

16,395 posted on 06/01/2025 12:28:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16193 | View Replies]

To: AdmSmith

I have thought since this all began, that the end would not be through military means, but through political upheaval in Russia caused by economic and social upheaval.

What are the positives for average Russian citizens 3+ years into pitin’s folly?
Huge numbers of their sons, fathers, and husbands dead and wounded. Extraordinary interest rates and inflation, food production collapsing, infrastructure collapsing, businesses failing, economy failing except for the MIC. That is what the average Russian citizen sees and feels.
Then let’s look at the macro.
Russian exports largely gone. Russia went from number 2 in military exports to net importer, profits from petro sales a fraction of what they were. 50$ a barrel for oil barely covers costs. National wealth fund nearly if not already depleted.

Internally pitin has made far more enemies than friends. Oligarchs who were made rich by pitin’s reign are feeling the full brunt of his actions in their bank accounts and in their personal lives.


16,396 posted on 06/01/2025 4:17:27 AM PDT by blitz128
[ Post Reply | Private Reply | To 16395 | View Replies]

To: blitz128

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Elite French Special Forces Obliterate Russian Spetsnaz Units! ]

Today [ May 31 ], there are a lot of interesting updates from the Kharkiv direction. Here, Russians launched their long-anticipated summer offensive on Kharkiv, aiming to reverse the losses suffered in 2022 and collapse the Ukrainian front from Vovchansk. But as Russian Spetsnaz units led the charge, they were met head-on by French special forces volunteers fighting for Ukraine, triggering an unexpected brutal clash.

The goal of the Russian forces in this area is to retake the territories lost to the Ukrainians during the 2022 Kharkiv counteroffensive and achieve what they failed to do last year in 2024. If Russians achieve a breakthrough at Vovchansk, they will continue their offensive along the Siversky Donets river and threaten to outflank the Ukrainian forces at Kupiansk, placing the Ukrainians at risk of frontline collapse, and taking much of territory in the process.

As you remember from a previous report, the Russians had already initiated the first phase of their attacks with large reconnaissance-in-force operations, meant to test the Ukrainian defenses, but were destroyed even before they crossed the administrative border. These and other assaults indicate that Russians are already setting their plans in motion.

Zooming into Vovchansk, the entire town was left in ruins, after the brutal fighting that took place during the initial Russian offensive of 2024 and subsequent positional battles within the town. The Russian forces are in control of the northern part of the town, holed up in basements, as there are no standing buildings left. Meanwhile, the Ukrainian forces are positioned in the southern part of the town along the riverbank and in the local aggregate plant, allowing the Ukrainians to maintain a tactical presence in the town.

This enduring tactical presence and the severe damage to the town itself created a no-man’s land between the Russian and Ukrainian lines, where the collapsed buildings and ruins prevent either side from establishing long-term positions.

In Vovchansk, the scale of destruction has left Russian infantry units exposed, with no intact buildings or basements for cover. Forced to operate in open rubble, they become easy targets for Ukrainian drones. Over a year of futile assaults has turned the town into a graveyard of Russian troops, each wave falling where the last one died, forced to walk over each other’s bodies.

Russians understood that making progress in Vovchansk is extremely unlikely, which is why they are now attempting to widen the front east of Tykhe, trying to overextend Ukrainian lines. The Russians initiated their assaults in this area by advancing through the forest, led by special forces operatives of Spetsnaz.

However, the Ukrainians did not leave this area undefended, as a contingent of Ukrainian foreign fighters was located there. The Russian special operatives were caught off guard as they encountered their match in elite, ex-special forces, French volunteers serving with the Ukrainian Military Intelligence.

The French opened fire on the Russians, prompting the Russians to fire back and reveal their positions, whereafter the French moved quickly to gain complete fire superiority. The distance between the French and the Russians was so close to the point that fighters of both sides could hear each other’s yelling and commands amidst the intense battle.

Unfortunately for the Russians, they were no match for the French ex-special forces. As the French advanced, moving past the bodies of the ones they killed, they directed artillery fire on the remaining Russian positions, decimating the Spetsnaz fighters and taking the day.

Overall, in Russian strategic doctrine, there is no diversionary offensive, as their forces will persistently try to exploit a breakthrough anywhere and whenever possible. This makes holding the line in the Kharkiv sector crucial, as maintaining a strong defense will make it unlikely that the Russians will continue their attacks and instead concentrate their forces elsewhere.

The first Russian soldiers to initiate the fighting and the foundation for these offensives are reconnaissance units, which in this case even included Spetsnaz fighters. However, with elite French foreign volunteers serving to counter the Russian threat, Russians stand no chance of achieving anything close to meaningful gains here.

https://www.youtube.com/watch?v=ZdbXSC4ZTCc


16,397 posted on 06/01/2025 4:40:57 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16396 | View Replies]

To: BeauBo

Watched a good video on collapse of potato production in Russia. Potatoes went from 30 rubles to 100 rubles per kilo, and most of the potatoes on the shelves are imported.
Additionally Russia would import its potato seed from Finland, and that has been cut off.

Pitin himself is on record talking about the potato shortage, next goes the Russians favorite,
Potato Water, the revolution 😂

The largest farm equipment manufacturer, which used to make massive amounts of combines, tractors …. for internal and export markets is bankrupt and crying for govt help.

Imagine being a US farmer and having to get loans at 21%+ interest rate.


16,398 posted on 06/01/2025 4:51:42 AM PDT by blitz128
[ Post Reply | Private Reply | To 16390 | View Replies]

To: blitz128
SBU (Ukr intelligence) is conducting a large-scale special operation to destroy enemy bomber aircraft in the rear of Russia. >More than 40 Russian aircraft have been attacked, incl strategic bombers Tu-95, Tu-22M3, and A-50 aircraft. The enemy's losses already exceed $2B. Video: head of SBU Malyuk

https://x.com/onestpress/status/1929143671334547602

16,399 posted on 06/01/2025 5:04:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16398 | View Replies]

To: AdmSmith


16,400 posted on 06/01/2025 5:11:06 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 16399 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,361-16,38016,381-16,40016,401-16,420 ... 20,241-20,258 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson