Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,301-12,32012,321-12,34012,341-12,360 ... 20,381-20,385 next last
To: BeauBo
As commitments continue to flow in, EU nations are upping their targets for the bloc’s new massive single military aid package for Ukraine.

Politico reports that the package’s expected value has risen to 20 billion euros, and may grow even larger as countries dig for equipment.

https://x.com/Osinttechnical/status/1893154597390151801


12,321 posted on 02/22/2025 7:40:18 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12320 | View Replies]

To: AdmSmith
It appears that physical nets for drone protection are not proving effective. Consequently, the Russians have opted to use smoke screens deployed by ground drones in the hope of shielding the remnants of their equipment.

https://x.com/wartranslated/status/1893307754065879471

The smoke will impact video equipped drones, but should not impact drones with thermal cameras.

12,322 posted on 02/22/2025 7:56:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12321 | View Replies]

To: PIF
A Russian evacuation group captured footage of Ukrainian drones striking their equipment on the "Road of Death" near Vyshneve in the Pokrovsk direction.

Upon seeing the video of their own work, the operators from the Ivan Franko Group decided to share their perspective, showing the battle through the eyes of the drone that was involved.

https://x.com/wartranslated/status/1893292296520528241


12,323 posted on 02/22/2025 7:59:26 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12322 | View Replies]

To: BeauBo
A Russian films a wrecked convoy near Sudzha, Kursk region, taken out by Ukrainian drones, complaining that their EW systems are useless.

Ukrainian fiber-optic drones cut right through their jamming.

Looks like another batch of "unmatched" technology just went up in smoke.

https://x.com/wartranslated/status/1893276006959448434


12,324 posted on 02/22/2025 8:11:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12323 | View Replies]

To: PIF
The Main Intelligence Directorate of Ukraine intercepted a conversation among Russian soldiers, where one soldier criticizes the "Kadyrovites," blaming them for the surrender of Kursk: "They're just a bunch of bearded bastards! They ran away, damn it!" He recounts how the Chechens abandoned their positions, leaving only a few men behind.

https://x.com/wartranslated/status/1893250862710960198

Once again, demonstrating poor COMSEC by the ruzzians.


12,325 posted on 02/22/2025 8:16:54 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12324 | View Replies]

To: FtrPilot
Drones from the Ukrainian Security Service successfully disabled the "Novovelychkovskaya" oil pumping station in Kuban, a critical facility for oil transportation in the region. The drone strike specifically targeted the 110/35/10 kV substation that supplies power to the pumping station. This resulted in a fire at the substation, leading to a complete power outage and an emergency shutdown of oil pumping operations. This operation marks the eighth successful strike by the SBU this year, causing substantial damage to Russian military logistics.

https://x.com/wartranslated/status/1893232961631162649

Novovelichkovskaya, Krasnodar Krai on Google Maps

12,326 posted on 02/22/2025 8:25:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12325 | View Replies]

To: All
General Staff confirms: On February 20, 2025, Ukraine's SBU, among other forces, struck the "Novovelychikivska" oil pumping station in Russia's Krasnodar region, servicing the Tikhoretsk–Novorossiysk-2 pipeline. The station supports Russian forces. Russia attempted to counter with ground-based air defense & Ka-52 helicopters, but to no avail.

https://x.com/NOELreports/status/1893333472896549028


12,327 posted on 02/22/2025 8:30:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12326 | View Replies]

To: FtrPilot

🤬 Russia does not want to exchange Ukrainian Azov and Marines prisoners and take back its soldiers from captivity, — Coordination Headquarters

❗️The occupiers are mostly interested in exchanging their conscripts and Chechens, and Russia “doesn’t care” about the rest.

https://bsky.app/profile/theukrainianreview.bsky.social/post/3lirfyafojk2b


12,328 posted on 02/22/2025 9:31:42 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12327 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Extensive Russian Rescue Mission Failed ]

Today [ Feb 22, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, after spending too much time fighting alongside North Korean troops, the Russians have started borrowing their tactics in a desperate attempt to break the siege on their stranded allies in Nikolske.

But as they charged forward in human waves, draped in Soviet flags and straight into Ukrainian fire, their rescue mission quickly turned into yet another battlefield catastrophe.

The goal of the Russian forces in this area is to reach the village of Nikolske and relieve the North Korean soldiers stuck on the outer edges of the settlement, left over from the previous assaults. This is because Ukrainians maintain strict fire control over all supply lines ot Nikolske, leaving the North Koreans completely cut off from resupply for over a week now.

To prevent Ukrainians from capturing a large part of the North Korean contingent, Russians attempted to link up with their allies by launching a massive mechanized assault over the fields. The Russians hoped that the mechanized assault units would be able to provide enough of a firepower advantage through their tanks and BMP infantry fighting vehicles, to expand their area of control, and relieve the North Koreans.

The main advantage of the Russian forces in this area is the extremely cold weather that has caused the ground to freeze solid, enabling Russian armor to move freely across the fields instead of being restricted to the heavily mined roads.

Furthermore, if we look at the topographic map, we can see that the Russian approaches are largely shielded from Ukrainian firing positions by a hill ridge, which shields them against targeting by Ukrainian ATGM positions for a large portion of their journey.

However, the Russian forces are severely disadvantaged once they cross the ridge, as they are directly exposed to Ukrainian fire on the hill ridge in the east, firing on top of the armored assault groups. Furthermore, the lack of tree lines in this last part of the journey gives Russians no cover for the most dangerous portion of their assaults.

Unfortunately for Russians, Ukrainians decided to make this already deadly kill zone even worse for the Russian armor. Ukrainians used remote mining techniques with drones and artillery to scatter a large number of landmines across these fields and, in the process, extending the minefield from around the roads to now filling entire fields.

Additionally, the clear weather allowed Ukrainians to increase their drone surveillance in the area, allowing for the Russian assaults to be detected even before they crested the hill.

Geolocated combat footage reveals how Russian forces launched mechanized assaults using several BTR armored personnel carriers and tanks. However, the column quickly came under attack by Ukrainian precision strikes, including kamikaze drones, landmines, and artillery fire.

Notably, Russian soldiers adorned their tanks and vehicles with Soviet flags, attempting to recreate the mass-charges of the past. However, as many of the Russian armored personnel carriers and tanks were rapidly being disabled, Russian soldiers resorted to advancing across open fields on foot.

These human wave formations, similar to previous North Korean assaults, ended in a complete disaster for the Russian infantry. The Russian vehicles that survived the initial ambush pressed forward, but were also quickly disabled and destroyed by Ukrainian precision fire, leaving dozens of wrecked vehicles scattered across the fields near Nikolske, as the besieged North Koreans could do nothing but watch the disaster unfold.

Overall, the Russians conducted a disastrous assault on Nikolske in the hope of relieving the cut-off North Korean forces, only for their plan to backfire, due to Ukrainians meticulously preparing a kill zone to efficiently deal with the Russian assault. These losses only further drain the already limited Russian reserves, while Ukrainians maintain powerful defensive positions that stand despite the intense pressure.

As the attempt to resupply the North Koreans stuck in Nikolske failed, the survivors of the latest Russian assault will only add to the supply issues, with more mouths to feed and wounded to take care of.


12,329 posted on 02/22/2025 2:27:49 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12328 | View Replies]

Day 1095 of the Russian invasion. 1,180 i.e. more than 49 Russians and Norks/h. Vehicles and fuel tanks more than 150% and artillery systems more than 150% above the average.


12,330 posted on 02/23/2025 3:24:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12313 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 22, 2025

Russian forces continue to deploy wounded and medically unfit soldiers to the frontline in an effort to address personnel shortages. A Russian milblogger published a video on February 21 showing injured personnel of the Russian 150th Motorized Rifle Division (8th Combined Army [CAA], Southern Military District [SMD]) complaining that the Russian command is sending them to conduct infantry assaults despite their injuries.[48] The soldiers claimed that they are members of the 150th Motorized Rifle Division's “150th Motorized Rifle Regiment” — which ISW has not observed engaged in combat in Ukraine or Kursk Oblast. The soldiers claimed that frontline Russian commanders removed them from their original units after they were injured and that they are in Kursk Oblast to prepare for redeployment into combat. It is unclear if the injured soldiers are currently in Kursk undergoing medical treatment or if the Russian military command intends to introduce elements of the 150th Motorized Rifle Division into combat in Kursk Oblast. ISW has recently observed reports that the Russian military command is redeploying elements of the 150th and 20th motorized rifle divisions from the Kurakhove direction to the eastern Pokrovsk and Toretsk directions but has not observed discussions of these formations redeploying to Kursk Oblast.[49]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-22-2025

12,331 posted on 02/23/2025 3:26:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12312 | View Replies]


12,332 posted on 02/23/2025 3:28:21 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12173 | View Replies]


12,333 posted on 02/23/2025 3:29:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12332 | View Replies]

To: blitz128; PIF; AdmSmith; FtrPilot; BeauBo

It is amazing to now see the melon portraying our peerless leader as a traitor or a spy of the KGB as he negotiates a peace. Perhaps he is not a direct Moscow troll but rather works with some other group of anti Ukraine Russians. At any rate an interesting change in focus. I wonder if JR has noticed what appears to be a shift away from Trump support by him.


12,334 posted on 02/23/2025 3:59:51 AM PST by gleeaikin ( Question authority as you provide links )
[ Post Reply | Private Reply | To 12308 | View Replies]

To: gleeaikin
Margaret Thatcher got the measure of Putin in 2000, following the Kursk submarine disaster

Poland & Thatcher, amongst others, knew that Russia's leaders never change Whether Tsar, Secretary General or President, their callous disregard for Russian lives remains a constant - as does their insatiable desire to dominate and conquer their neighbours.

https://x.com/RafHM/status/1892646279752130610
2 min video

12,335 posted on 02/23/2025 4:09:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12334 | View Replies]

To: PIF; gleeaikin
Кремлевская табакерка 22FEB2025:
“Vladimir Vladimirovich will be one of the first participants in the “Kukushka” project. There will be at least ten good children”

This was told to us by philosopher Alexandr Dugin. This is how he commented on the channel's information that the “Kukushka” project, within the framework of which women will give birth to children for the state, will start at the end of this year or the beginning of next year. Alexandr Gelyevich previously called Vladimir Putin's participation in the project and the conception of “special” children necessary. “ You wrote that you have no information about Vladimir Vladimirovich's participation in the project. Nonsense! I am reporting (information from extremely informed sources) that the president will be one of the first participants in “Kukushka”! He will have at least ten children. Good, special, truly Russian state children. And I hope more,” Dugin claims.

He also reported that progress is being made on his proposal to remove Lenin's body from the Mausoleum and free up the building “for the future” for the current president ( see https://freerepublic.com/focus/bloggers/4219673/posts?page=11328#11328 ).

It should be noted that sources in the Kremlin have not yet refuted, but have not confirmed these statements by Dugin.

https://t.me/kremlin_secrets/5325

12,336 posted on 02/23/2025 4:42:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12335 | View Replies]

Project “Kukushka”. Some women may start giving birth to children next year specifically for the state https://freerepublic.com/focus/f-news/4291059/posts


12,337 posted on 02/23/2025 4:46:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12336 | View Replies]

To: AdmSmith
Magyar shares footage of his drones at work. Fibre optic FPV drones are already operating 20km deep behind Russian lines.

https://x.com/NOELreports/status/1893632328108220538


12,338 posted on 02/23/2025 4:55:29 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12327 | View Replies]

To: PIF
A very large Shahed attack on Ukraine was mostly repelled overnight. Russias launched 267 (!) Shahed drones and simulator type drones. A total of 138 were shot down and 119 more were supressed by electronic warfare.

https://x.com/NOELreports/status/1893589596396490982

Ten Shahed drones made it to their target.


12,339 posted on 02/23/2025 5:09:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12338 | View Replies]

To: BeauBo
💥 Destruction of two D-20 and two D-30 guns.

https://x.com/Maks_NAFO_FELLA/status/1893638529919414512


12,340 posted on 02/23/2025 5:17:09 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12339 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,301-12,32012,321-12,34012,341-12,360 ... 20,381-20,385 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson