Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,241-11,26011,261-11,28011,281-11,300 ... 18,761-18,775 next last
To: blitz128

Additionally Russia is china’s B


11,261 posted on 02/01/2025 12:44:02 PM PST by blitz128
[ Post Reply | Private Reply | To 11260 | View Replies]

To: JonPreston

11,262 posted on 02/01/2025 12:57:55 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11259 | View Replies]

To: JonPreston
LINK

Ukraine: Transgender women weep as authorities classify them as ‘men’ who must stay and fight


11,263 posted on 02/01/2025 1:22:01 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11262 | View Replies]

To: blitz128; PIF; BeauBo; FtrPilot

Super Bowl party idea. Its a family favorite. We fix it every year.

Its a Jalepeno Dip. Copied from Chuys Restaurant - founded in Austin.

1 qt Mayo
8 oz Sour Cheese
11 oz Diced Jalepenos, drained
11 oz Tomatillos, drained (usually can only get in a 28 oz can)
1/2 bunch Cilantro
3 packs Hidden Valley Buttermilk dressing (dried packs, not a liquid dressing)

Combine all ingredients (except mayo) in a food processor. Transfer to a large container, then hand whisk in the mayo. Whisk until no mayo lumps.

Best served cold. So recommend to fix 1 day early and refrigerate.

Eat the dip with tortilla chips, cherry tomatoes, mini cucumbers, bell peppers.

Subsequent days, add the jalapeno dip to fish or chicken tacos.

Link to tomatillos: https://www.heb.com/product-detail/la-costena-tomatillos-28-oz/193667

Jalepenos: https://www.heb.com/product-detail/mt-olive-jalapeno-slices-fresh-pack-12-oz/1053357

Dressing: https://www.heb.com/product-detail/hidden-valley-buttermilk-ranch-salad-dressing-seasoning-mix-0-4-oz/163620

Best,
Bill


11,264 posted on 02/01/2025 2:06:35 PM PST by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 11261 | View Replies]

Russian Offensive Campaign Assessment, February 1, 2025

Russian milbloggers continue to complain about problems with Russian armored vehicles. A Russian milblogger complained on February 1 that the Russian military is struggling to transport infantry in frontline areas on armored vehicles and that Russian forces are suffering high losses during transport — likely due to Ukrainian drone strikes.[55] The milblogger criticized the Russian MoD’s unwillingness in previous decades to innovate armored vehicles and called for Russia to develop an analog to the US M113 armored personnel carrier.[56]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-1-2025


11,265 posted on 02/02/2025 2:18:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11231 | View Replies]



The meat grinder must be fed.
11,266 posted on 02/02/2025 2:22:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11168 | View Replies]

1,320 i.e. more than 55 Russians and Norks/h. Vehicles and fuel tanks + artillery systems more than 100% above the average. Only small # tanks the last week => the Russians lack heavy systems.


11,267 posted on 02/02/2025 2:43:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11192 | View Replies]

The Russians lack drones, look at this Ukrainian tank attacking without resistance.

💥👊 Ukrainian tanks fire at buildings with Russian infantry at close range in Krymskoe, Donetsk region.

https://x.com/maks_nafo_fella/status/1885268600803504487
2 min video

11,268 posted on 02/02/2025 2:47:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11267 | View Replies]

🚙😵‍💫 Increasingly, Russians at the front are using this during attacks...

https://x.com/Maks_NAFO_FELLA/status/1885991115016241557

11,269 posted on 02/02/2025 2:50:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11268 | View Replies]

To: AdmSmith

830,000 casualties of which 400,000 required treatment off the battlefield, potentially leaving 430,000 dead. A number which one would expect given 2 years of conducting meat wave attacks.


11,270 posted on 02/02/2025 4:52:21 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11266 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Funnel of Death: Ukrainians Obliterate Russian Convoys! ]

Today [ Feb 01, 8 pm ], there are a lot of interesting updates from the Kupiansk direction.

Here, the Russian forces push forward in their bid to expand control along the Oskil River, relying on mechanized assaults to break through Ukrainian defenses.

However, with poor logistics and relentless Ukrainian drone strikes turning their armored columns into burning wrecks, the battle for Kupiansk’s southern flank becomes a brutal test of endurance.

The goal of Russian forces in the area is to expand their control along the Oskil River and reach the city of Kupiansk. This is the most important sector of their longstanding effort to eliminate the Ukrainian bridgehead across the Oskil River, consolidating their gains in the Luhansk region on an operational level.

To achieve this objective, Russian forces have slowly worked their way to the river at the settlement of Kruhliakivka. To further support these efforts, Russians are trying to reinforce their infantry along the river with armored units, hoping to give them the firepower needed to finally achieve a breakthrough.

If we take a look at the topographic map, we can see that the main advantage of the Russian forces is their high-ground positions from which they can support their efforts along the Oskil River. Furthermore, the gully through the settlement of Pischane is surrounded on two sides by these high grounds, allowing them to move their forces through here in relative safety from direct Ukrainian fire.

However, Russian movement through the gully is heavily complicated by the absence of hardened roads through the lowlands. With the lowlands also being more prone to flooding and muddy terrain, this path becomes basically unusable during the muddy seasons. This forces Russians to increasingly use the roads on the high ground, risking increased exposure to Ukrainian fire.

Furthermore, Russians operate over 40 kilometers from their supply hub in Svatove, decreasing the effectiveness of their supply lines. Additionally, once they attempt to drive toward their positions along the Oskil River, Russian forces quickly come under an intense Ukrainian crossfire, with FPV drones flying in from both sides along the entire stretch of their spearhead.

The fact that Russians must drive 15 kilometers to reach the river, along with their diminished maneuverability and lack of cover, gives Ukrainain drone operators plenty of time to detect Russian vehicles moving toward the River, and unleash a swarm of FPV kamikaze drones on them.

Geolocated footage reveals the detection of Russian BTR-82 armored vehicles moving to dismount stormtroopers at Kruhliakivka. However, unfortunately for the Russians, the drone operators of the Achilles battalion of the 92nd Infantry Brigade quickly detected them and knocked out the vehicles, which forced the infantrymen to try and advance on foot.

This only exposed them to additional strikes where the drone operators eliminated the Russian soldiers one by one. At the end of the operation, in just several minutes, the Ukrainian drone operators managed to knock out 4 Russian BTR armored vehicles and 7 soldiers, while the remaining survivors were forced to withdraw.

Hereafter, Russians continued sending additional waves of mechanized units, including tanks to reinforce their infantry fighting along the riverbank. This only led to a increase in losses as the Ukrainian drone operators kept destroying any Russian armored equipment attempting to reach the fighting along the river.

As a result of these operations, the Ukrainians destroyed over 15 Russian armored vehicles in the last 5 days alone, with many more destroyed in previous weeks.

Overall, due to the poor logistics and lack of infrastructure in the southern flank of Kupiansk, the Russian forces were exposed to precision strikes by FPV kamikaze drones of the Ukrainian Achilles Battalion of the 92nd Infantry Brigade.

The success of the Achilles Battalion in repulsing several Russian mechanized attacks on the southern flank of Kupiansk, over the past months, allowed them to expand from a battalion to a regiment, increasing the size or their unit by nearly 4 times.

The huge influx of new Ukrainian drone operators will allow them to counter the Russian attacks to even greater effect, further deteriorating the Russian situation here, and possibly even set conditions for Ukrainians to retake the east bank of the Oskil River.


11,271 posted on 02/02/2025 4:52:49 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11269 | View Replies]

To: PIF
The Kremlin has established new deadlines for its military operations in Russia's Kursk Oblast, setting 1 February 2025 as the target date for regaining full control over the region after failing to meet the previous October deadline. Sources within Ukraine's Defense Forces told RBC-Ukraine that Russian plans also include creating a buffer zone across the border in Ukrainian territory by 25 February.

According to RBC-Ukraine sources, in August, Vladimir Putin ordered his military to expel Ukrainian forces from Kursk Oblast by 1 October while maintaining forces in key Donbas sectors in eastern Ukraine.

https://euromaidanpress.com/2024/10/22/media-russia-sets-new-february-deadline-to-expel-ukrainians-from-kursk-after-october-failure/

11,272 posted on 02/02/2025 5:02:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11271 | View Replies]

To: AdmSmith

“ 1 February 2025 as the target date for regaining full control over the region”

What am I missing, at least in my non-Russian mir world, today is 2 feb 😂


11,273 posted on 02/02/2025 5:07:47 AM PST by blitz128
[ Post Reply | Private Reply | To 11272 | View Replies]

To: AdmSmith

Develope an analog for a 50-60 year old system?

Humm okay 😎


11,274 posted on 02/02/2025 5:16:19 AM PST by blitz128
[ Post Reply | Private Reply | To 11265 | View Replies]

To: SpeedyInTexas

Sounds good, not a pro football fan, but always looking for a good appetizer 😀


11,275 posted on 02/02/2025 5:18:02 AM PST by blitz128
[ Post Reply | Private Reply | To 11264 | View Replies]

To: blitz128
🔥⚡️Two 🇷🇺 Russian invaders on ATV hit an anti-tank mine TM-62 in Donetsk region

You need to look not at the sky in search of a drone, but at the ground :)

https://x.com/GloOouD/status/1886042797582528593


11,276 posted on 02/02/2025 5:54:55 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11273 | View Replies]


11,277 posted on 02/02/2025 6:39:07 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11271 | View Replies]

To: JonPreston
American Foreign Policy


11,278 posted on 02/02/2025 7:01:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11277 | View Replies]

To: AdmSmith

Did the Kremlin mention which year?


11,279 posted on 02/02/2025 7:42:49 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 11272 | View Replies]

To: Mr. Lucky

Yes the completion date was yesterday. Guess they missed it.


11,280 posted on 02/02/2025 7:54:28 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11279 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,241-11,26011,261-11,28011,281-11,300 ... 18,761-18,775 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson