Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,201-11,22011,221-11,24011,241-11,260 ... 22,121-22,139 next last
This is the proper way to treat a communist who supports Zelensky and the war

BREAKING: John Brennan has been banned from entering any Federal Building.

This was ordered by President Trump. pic.twitter.com/WOLLij2K95— Ian Jaeger (@IanJaeger29) January 31, 2025


11,221 posted on 01/31/2025 10:15:39 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11216 | View Replies]

To: AdmSmith

Only 10 more to go!!


11,222 posted on 01/31/2025 10:22:17 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11219 | View Replies]

MAHA Health Tip of the DAY!

Do not, repeat, DO NOT! take any vaccine product endorsed by this man


11,223 posted on 01/31/2025 10:35:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11222 | View Replies]

To: PIF

BINGO?


11,224 posted on 01/31/2025 11:00:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11222 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Final Chapter: Last Road Cut. Perimeter Breached ]

Today [ Jan 31, 8 pm ], the most important updates come from the Velyka Novosilka direction.

Here, the battle for Velyka Novosilka reached a critical turning point, as Russian forces pushed forward, leveraging their numerical superiority and high-ground advantage.

With the last remaining Ukrainian supply route under attack and relentless assaults underway, the fate of Velyka Novosilka was at stake.

After months of intense fighting, the Russian forces continued their offensive effort to take control of Velyka Novosilka. Despite being relatively small, Velyka Novosilka is still the largest town in 40 kilometers of fields and minor settlements, resulting in it being a key logistical node due to the many hardened roads running through it. This makes Velyka Novosilka a vital logistics hub to supply and sustain any future operations for either side.

To capture the town, Russians are avoiding direct assaults and urban combat by instead attempting to cut off key Ukrainian logistics routes leading into Velyka Novosilka.

Russian forces already held physical control of two out of three logistics roads, leaving the Ukrainian garrison with only the road in the west running through Vremivka. As cutting off this road would allow the Russian forces to cut off all supplies and reinforcements to the Ukrainian garrison in the town, Vremivka became the main focus point of the Russian offensive.

If we look at the topographic map, we can see that Vremivka and Velyka Novosilka are located in the lowlands of the river valley, while the Russian forces in the north, east, south, and west maintain positions on much higher elevations. This allowed the Russian forces to enforce fire control over the Ukrainian garrison in Velyka Novosilka, and support any of their assaults from up the hill.

The steep slope also gave Russians a large reconnaissance advantage, as their aviation and artillery intensely bombed the Ukrainian garrison in the town below. Lastly, the village of Vremivka is part of a larger agglomeration of settlements stretching to the south, allowing Russians to infiltrate through the settlements as well.

However, as you may remember, the agglomeration of villages south of Vremivka was the site of the Ukrainian 2023 counteroffensive, and the heavy fighting left the towns completely reduced to ruins, eliminating the cover advantage for the Russians. This allowed the Ukrainian forces to intensely target Russians moving into the town with artillery and drones.

Furthermore, Russians had to cross wide open fields to reach Ukrainian positions, increasing their exposure to Ukrainian reconnaissance drones and artillery fire.

Geolocated combat footage from the area reveals the detection of over 14 Russian stormtroopers by Ukrainian drone operators due to their exposure in the open fields. The Ukrainian drone operators relayed their coordinates to the crew of nearby artillery batteries, which swiftly reacted and shelled the Russian forces, thwarting their attack.

This led to the destruction of the Russian infantry with all 14 soldiers eliminated, and no survivors left in this wave of attack. Other Russian forces that were not all detected and targeted by artillery shelling managed to enter the outskirts, only to be eliminated by drone strikes and Ukrainian small-arms fire.

Unfortunately, in the end, this wasn’t enough to counteract the overwhelming Russian numerical advantage and tactically superior positions. Reports from Ukrainian soldiers on the ground indicate that Russians had a 3:1 advantage in terms of manpower and were shelling the town day and night. Russians were also able to fully utilize their positions on the high ground to support their assaults on Vreminka.

After Vreminka fell, they managed to cut off most Ukrainian supplies into Velyka Novosilka, spelling the end for the Ukrainian garrison. As Russians intensified their assaults and started establishing footholds within the town, Ukrainians understood that the perimeter was breached. They conducted a full withdrawal, with a rear-guard action to prevent Russians from overrunning them.

Overall, despite the Ukrainians’ best efforts, the Russians were able to leverage their numerical superiority in combination with their high-ground advantage to take Velyka Novosilka. The Ukrainian withdrawal was relatively successful, as Russians had dedicated most of their artillery support to target the entries to the town, allowing most Ukrainian groups to withdraw in good order.

Despite the dynamic end of the battle of Velyka Novosilka, with Russians raising the flag over the town, western military analysts state that the front line will not collapse, due to the difficult terrain and natural obstacles.


11,225 posted on 01/31/2025 11:18:13 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11224 | View Replies]

To: PIF

🍈🦆


11,226 posted on 01/31/2025 12:48:44 PM PST by blitz128
[ Post Reply | Private Reply | To 11213 | View Replies]

To: blitz128

Might not make 🍈 happy
https://freerepublic.com/focus/f-news/4294003/posts


11,227 posted on 01/31/2025 4:17:18 PM PST by blitz128
[ Post Reply | Private Reply | To 11226 | View Replies]

To: BeauBo; FtrPilot; PIF

Indications Russia is going to launch a mass cruise missile attack on Ukraine in a few hours.


11,228 posted on 01/31/2025 6:07:00 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 11193 | View Replies]

To: marcusmaximus

Usually the worst things in war happen right before negotiations.


11,229 posted on 01/31/2025 6:09:36 PM PST by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 11228 | View Replies]

To: dfwgator

Both sides getting their last licks in.


11,230 posted on 01/31/2025 6:18:49 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 11229 | View Replies]

Russian Offensive Campaign Assessment, January 31, 2025

Western and Ukrainian officials continue to report that North Korean forces have withdrawn from frontline positions in Kursk Oblast. The New York Times (NYT) reported on January 30 that Ukrainian and US officials stated that the Russian military command pulled North Korean forces in Kursk Oblast from the battlefield after suffering heavy casualties and that Ukrainian forces have not seen North Korean forces in the area for about two weeks (since about January 17).[103] US officials noted that the withdrawal of North Korean forces from the battlefield may be temporary and that North Korean forces could return to combat after receiving more training or after the Russian military command comes up with a way to deploy the North Korean forces and avoid such high losses. A Ukrainian official stated that North Korean forces’ disorganization and lack of cohesion with Russian forces quickly increased North Korean casualties. Ukrainian officials and soldiers stated that North Korean forces had been advancing with few armored vehicles and rarely paused to regroup or fall back. The NYT reported that North Korean dictator Kim Jong Un might expect Russia's help in advancing North Korea's missile program as well as diplomatic assistance at the United Nations (UN) in exchange for sending North Korean forces to Russia. ISW recently reported that North Korean forces likely withdrew from active combat operations in Kursk Oblast.[104] Ukrainian Ground Forces Commander Colonel General Oleksandr Syrskyi recently stated that Ukrainian forces have inflicted roughly 5,500 causalities on the 11,000 to 12,000-strong North Korean military contingent since November 2024.[105] The reported withdrawal of North Korean forces follows repeated statements from Ukrainian officials noting that North Korean troops were suffering unsustainable casualty rates in Kursk Oblast.[106]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-31-2025

11,231 posted on 02/01/2025 1:16:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11191 | View Replies]

1,430 i.e. more than 59 Russians and Norks/h. Vehicles and fuel tanks + artillery systems more than 100% above the average.


11,232 posted on 02/01/2025 1:34:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11192 | View Replies]

To: marcusmaximus; gleeaikin; PIF
Кремлевская табакерка

In prayers for Putin's life and health, they began to call him an emperor.

This order was given personally by Patriarch Kirill. “In prayers for the life and health of Vladimir Vladimirovich, which are read by individual, specially selected bishops, for several days now the president has been called the great emperor and almighty of the Russian lands. It sounds beautiful and respectable,” a source in the Church told us. It should be noted that the Russian Orthodox Church has divided opinions on this decision. Hierarchs close to the patriarch say that “everything is correct, because the country under our president is growing, expanding, and in Vladimir Vladimirovich's power there are many signs of the power of an emperor - as in the Russian Empire.”

Bishops and priests who are opposed to Kirill (and there are plenty of them) reproach him for “excessive flattery and not entirely clear actions.” “Our patriarch, it turns out, envied Mr. Dugin. He, as is known, called Vladimir Vladimirovich the emperor (and even offered to free the Mausoleum for him by taking Lenin's body out of there, - ed.). The Patriarch decided to defeat Alexander Gelyevich and has already recognized Vladimir Vladimirovich as the emperor. But this is unlikely to help our esteemed primate,” a source in the Russian Orthodox Church close to Tikhon (Shevkunov) believes. The head of the Crimean Metropolitanate, we recall, is considered in the Kremlin as a likely successor to Kirill on the patriarchal throne. By the way, we do not know how Vladimir Putin himself reacted to the fact that he was called the emperor. It is only known that there have been no objections to this at the moment.

https://t.me/kremlin_secrets/5238

Who will go first Kirill or Putin?

11,233 posted on 02/01/2025 1:54:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11230 | View Replies]

Only Three Groups in Russia Benefiting from War and Both They and Amounts of Money Involved Smaller than Most Imagine, Researcher Says

Paul Goble, Staunton, Jan. 28 – Only three groups have benefited from Putin's war in Ukraine – soldiers and their families, workers in the military-industrial complex and business owners – but these groups are smaller and the amounts of money they're receiving less than is commonly assumed, a researcher speaking on condition of anonymity says. As a result, the war has done little to change Russia from one of the most unequal countries in the developed world; and once it ends, he says, the situation may even get worse in that regard, forcing the government to change its approach or increase repression still further (https://meduza.io/en/feature/2025/01/28/the-end-of-the-war-will-herald-far-more-challenges-for-the-regime-than-the-war-itself).

Some of Russia's wealthiest people have indeed “gotten a lot richer” because they were able to divide “productive assets that were effectively abandoned by Western companies;” and that in turn allowed Putin to win their continued support. But presumably if the war ends, so too will that possibility. Among Russia's more numerous and much poorer strata, even those who are benefiting are spending in ways that have only a small multiplier effect. And if peace comes, that will disappear. As a result, income inequality will become worse, and social discontent will emerge in Russia.

As a result, the observer concludes, Russia “might actually become more repressive – have to become more repressive – if the war ends or if the war continues, just as a way of keeping a handle on things,” hardly the outcome most other observers and activists are now talking about.

https://windowoneurasia2.blogspot.com/2025/01/only-three-groups-in-russia-benefiting.html

11,234 posted on 02/01/2025 3:27:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11233 | View Replies]

Prilepin Equates Enemies of Soviet Power with Enemies of Russia, Deepening Divisions among Russian Nationalists who Support Putin's War in Ukraine
Paul Goble Staunton, Jan. 24 –

In the Putin era, there has always been a deep division between Russian nationalists who support the Soviet past and those who view the Soviet system as an enemy of the Russian nation almost as dangerous as “the Anglo-Saxons.” But now this division has deepened and likely made the two sides irreconcilable.

Zakhar Prilepin, a Russian nationalist writer who views the Soviet Union favorably, has equated those Russian nationalists who don't as “enemies of Russia” and published a list of them, even though many of the latter are prominent supporters of Putin's war in Ukraine ( https://dzen.ru/a/Z5M-TkKySTiC_A-3).

His attack has outraged many who have voiced their views (”The Execution List”. Nationalists against Zakhar Prilepin
https://www.svoboda.org/a/rasstreljnyy-spisok-natsionalisty-protiv-zahara-prilepina/33289542.html). But more important than that, it has divided the most vocal supporters of Putin's war, something that the Kremlin leader will find it far more difficult to overcome.

Indeed, by allowing the attack, Putin has weakened his own position as those who agree with Russian nationalists who don't like the Soviet past are likely to find it far easier to speak out against Prilepin who appears to be articulating the Kremlin leader's position on this point and perhaps ultimately on others as well.

https://windowoneurasia2.blogspot.com/2025/01/prilepin-equates-enemies-of-soviet.html

Zakhar Prilepin:

https://en.wikipedia.org/wiki/Zakhar_Prilepin

blog https://dzen.ru/id/6091546c064ac9639c18017d

Igor Strelkov was critical of Prilepin’s activities in Donbass, (2023) stating that Prilepin is “a crook who, for the sake of political PR, invents non-existent exploits in Donbass... He did not fight, he just did PR. Basically, all his military actions were in Donetsk restaurants. (Ru Wikipedia)

This is important to understand when analyzing Russia after Putin.

11,235 posted on 02/01/2025 3:55:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11234 | View Replies]

To: blitz128

Little Marco keeps saying “both sides”, as if UKR provoked Russia like our resident 🦠s & 🍈 insist.

The only pertinent part of the interview is:

“Well, the point is that he ( Putin ) has got his own domestic considerations. And so does Zelenskyy, right? I mean, at the end of the day he’s got - if you image if you’re a Ukrainian, the Russians have made you suffer so much, and now you’re going to let them keep land? I mean, the people would be upset about that in Ukraine, and you would understand it. And then there’s the mature realities of life on this planet, and that’s where this work is going to have to be defined.

“Both sides are paying a heavy price for this. Both sides have incentive for this conflict to end. Both sides are in a - it’s not going to end with the maximalist goals of either side, and there’s going to have to be a lot of hard work done. And I think only the United States, under the leadership of President Trump, can make that possible. But it won’t be easy, and it’ll take some time. But it’s certainly something I know he’s strongly committed to being - to seeing happen. “


He seems to not understand that Russia’s “incentive for this conflict to end” is to regroup, rearm, and to attack again. Russia’s ‘end’ is is only a means to be successful in taking the rest of Europe an England. Putin is counting on the nativity of Americans - 47 may be smart, but Little Marco is not. This will be a test of both, whether they let Russia keep any land and by extension, China take and keep Taiwan.

If this is just a blind knee-jerk reaction to stop the killing, then any negotiations will grant Russia most of what it wants, and little, if anything, UKR wants.


11,236 posted on 02/01/2025 5:01:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11227 | View Replies]

To: AdmSmith

Only three groups have benefited from Putin’s war in Ukraine – soldiers and their families,


With most of one million soldiers dead and wounded, I fail to see how soldiers and their families benefit.

Researcher says ....


11,237 posted on 02/01/2025 5:08:29 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11234 | View Replies]

To: AdmSmith

Ukraine’s Intel Chief Disputes Claim That North Koreans Have Fled The Russian Front
Lt. Gen. Kyrylo Budanov told us that 8,000 North Koreans are still fighting on the front lines in Kursk, but at a reduced capacity.
https://www.twz.com/news-features/ukraine-intel-chief-disputes-claim-that-north-koreans-have-fled-kursk-front


Weaponizing Space Key To Trump’s Iron Dome Missile Defense Shield Vision
The very ambitious Iron Dome plan calls back to Reagan’s “Star Wars,” and notably lacks any explicit mention of drone threats.
https://www.twz.com/news-features/weaponizing-space-key-to-trumps-iron-dome-missile-defense-shield-vision


11,238 posted on 02/01/2025 5:09:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11235 | View Replies]

To: PIF

There has been zero credible evidence of North Korean troops in Ukraine but be my guest providing evidence that supports The Zelenskies.


11,239 posted on 02/01/2025 6:19:11 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11238 | View Replies]

To: PIF

Good analysis, I will wait to see what Trump does.
Personally I see Russia as a prelude to China, and I think Trump knows that .China is waiting to see what Trump does.


11,240 posted on 02/01/2025 6:19:51 AM PST by blitz128
[ Post Reply | Private Reply | To 11236 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,201-11,22011,221-11,24011,241-11,260 ... 22,121-22,139 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson