Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,541-10,56010,561-10,58010,581-10,600 ... 22,101-22,114 next last
To: BeauBo

“This may indicate that the (Russian) ship has not received permission to enter the port (of Tartus) from the new Syrian authorities”

Maybe Turkey does not want to have to fight that gear in Libya.


10,561 posted on 01/10/2025 7:02:15 AM PST by BeauBo
[ Post Reply | Private Reply | To 10560 | View Replies]

To: AdmSmith

“This may indicate that the (Russian) ship has not received permission to enter the port (of Tartus) from the new Syrian authorities”

Maybe Trump suggested it.


10,562 posted on 01/10/2025 7:11:24 AM PST by BeauBo
[ Post Reply | Private Reply | To 10559 | View Replies]

To: BeauBo; AdmSmith
The US is set to introduce some of its harshest sanctions yet on Russia's oil sector, targeting 180 vessels, two oil majors (Gazprom Neft & Surgutneftegaz), and Russian ship insurers.

These measures aim to disrupt oil exports to key buyers India & China.

https://x.com/NOELreports/status/1877729290772480182

Over the past couple of years, the idiots in the biden administration did not want to disrupt the world petroleum market.

They tried to limit ruzzian profit, but wanted ruzzian oil to be delivered.

Now that President Trump is about to take over, the biden admin is trying to disrupt the flow of oil and raise the price of oil to damage President Trump.

10,563 posted on 01/10/2025 7:31:56 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10560 | View Replies]

To: BeauBo

Rumors have also begun to spread that in exchange for permission to remove all military property, the Syrians are demanding that Russia return Assad to the country for further trial for all crimes committed.

This position probably emerged after negotiations with the Foreign Ministers of Germany and France, who expressed their support and readiness to assist in an international investigation into the joint mass crimes of the Assad regime and the Russian military.

https://russiavsworld.org/syria-blocks-russian-ship-from-entering-tartus/

Note to other Russian-backed dictators: Do not trust Moscow


10,564 posted on 01/10/2025 7:35:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10560 | View Replies]

To: FtrPilot
raise the price of oil to damage President Trump.

It is the opposite, this will increase the percentage of US oil on the market.

10,565 posted on 01/10/2025 7:38:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10563 | View Replies]

+ https://www.reuters.com/business/energy/us-oil-executives-expect-faster-permitting-under-trump-says-dallas-fed-2025-01-02/


10,566 posted on 01/10/2025 7:45:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10565 | View Replies]

To: AdmSmith
It is the opposite, this will increase the percentage of US oil on the market.

I agree!

Drill baby drill.

10,567 posted on 01/10/2025 7:48:42 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10565 | View Replies]

To: BeauBo
Serbia finally realized that most of Russia's weaponry isn't really that good.

https://x.com/P_Kallioniemi/status/1877739099169186082

Will India also abandon ruzzian weapons?

10,568 posted on 01/10/2025 8:23:49 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10567 | View Replies]

To: FtrPilot

OT:
Monday’s upcoming StarShip Flight 7 will be essentially a new Starship, with huge internal and external improvements - it will carry 25% more fuel, for one. It will also launch 10 Starlink v3 simulator satellites - 160 gigs of uplink capacity, 1 terabyte of downlink speed. This is 10 times the downlink and 24 times the uplink capacity of the current mini version.

These V3s were supposed to fly earlier, but because of the ( Biden Admin deliberate ) delays, they were forced to launch the mini’s on falcon 9s. 2024 featured 89 dedicated Starlink launches.

The booster will for the first time also reuse an engine - a milestone toward reusing an entire booster.

Flight 8 may feature a Starship catch - a necessary step. This will feature removal of standard tiles in the upper area and replaced with multiple versions of metallic tiles, including one with metallic cooled tiles. The heat shield is still a work in progress.

On Flight 6, damaged sensors prevented booster capture. Apparently they were damaged by the launch tower and that has been fixed.

This flight is very important, if NASA wants to go to the Moon by 2026. With all the improvements, it is a big ask for every thing to go right on this first test.


10,569 posted on 01/10/2025 9:01:39 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10568 | View Replies]

To: PIF

United States, Canada, And Finland Sign MOU to Build Arctic And Polar Icebreakers - Release Date: November 13, 2024

https://www.dhs.gov/news/2024/11/13/united-states-canada-and-finland-sign-mou-build-arctic-and-polar-icebreakers


10,570 posted on 01/10/2025 1:27:16 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10557 | View Replies]

To: AdmSmith

“Rumors have also begun to spread that in exchange for permission to remove all military property, the Syrians are demanding that Russia return Assad”

Perhaps Assad’s botched poisoning was supposed to provide Russia a face saving way to return him (his body) for the ransomed equipment, after his “suicide”. (then they get to rob his wealth as well).

The sudden divorce discussion around the Assad’s, may have been an attempt to get the wife and kids to safety, because there is Hell to pay for what the Assad Regime has done.


10,571 posted on 01/10/2025 2:32:16 PM PST by BeauBo
[ Post Reply | Private Reply | To 10564 | View Replies]

To: FtrPilot

“Will India also abandon ruzzian weapons?”

They are contracting for Western Jets and other weapon systems, as well as building domestic capacity to sustain the legacy Russian weapon systems they have, at an aggressive rate.

They are clearly transitioning, but it is a huge job for them, after so many decades of investment.


10,572 posted on 01/10/2025 2:37:13 PM PST by BeauBo
[ Post Reply | Private Reply | To 10568 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, January 10, 2025

Ukrainian forces struck a Russian ammunition and drone storage warehouse in Rostov Oblast on the night of January 9 to 10. Sources within Ukraine's Security Service (SBU) told Ukrainian outlets Suspline and ArmyTV that Ukrainian forces struck a Russian military warehouse near Chaltyr, Rostov Oblast with drones and Neptune anti-ship cruise missiles.[1] The sources stated that Ukrainian forces used the drones to overwhelm and exhaust Russian air defenses in the area before launching Neptune missiles at the warehouse. The sources stated that Russian forces use reconnaissance drones from this warehouse to correct Russian strikes on Ukrainian cities and frontline positions. Rostov Oblast Governor Yury Slyusar stated that Russian forces downed 16 Ukrainian drones over the oblast and that the strike caused a fire at an industrial enterprise just north of Chaltyr.[2] Russian opposition outlet Astra assessed that the fire occurred at a plastic coating production plant in the area.[3]

The United States, United Kingdom, and Japan announced new sanctions against Russia on January 10. The US Treasury Department announced on January 10 that the United States imposed sanctions against Russian state-owned Gazprom Neft and Surgutneftegas, 183 Russian-connected vessels – many of which are part of Russia's shadow fleet – and dozens of oil traders, oilfield service providers, insurance companies, and Russian energy officials.[8] The United Kingdom announced that it also sanctioned Gazprom Neft and Surgutneftegas on January 10.[9] Japan announced additional sanctions against Russia, including asset freeze measures against 33 organizations and 12 individuals and export bans and other measures against 53 organizations from countries including Russia and the People's Republic of China (PRC) in order to strengthen Japan's response to North Korean support for Russia's war in Ukraine.[10]

The EU recently transferred three billion euros (about $3.07 billion) to Ukraine, the first tranche of EU funding from the profits of frozen Russian assets. Ukrainian Prime Minister Denys Shmyhal announced the transfer on January 10 and stated that Ukraine will use the funds for priority expenditures.[11] The G7 Extraordinary Revenue Acceleration (ERA) Loans initiative will provide a total of $50 billion to Ukraine from the profits of seized Russian assets, including a total of $20 billion from the EU.[12]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-10-2025

10,573 posted on 01/11/2025 1:31:01 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10545 | View Replies]

The Armed Forces of Ukraine allowed a 30,000-strong group of the russian Federation to quietly withdraw from Kherson due to US pressure on Kiev, - Bob Woodward after a conversation with US officials in the book “War”.

📍When the Ukrainian army liberated Kherson, American intelligence warned that the risk of a nuclear attack would increase if the russians lost their main forces while retreating from the city.
📍According to the plan, the armed forces were to pursue the retreating russians and carry out massive attacks, but this did not happen - the russians retreated without significant losses.
📍Before the withdrawal of the russians, the Americans warned Biden that shelling the Armed Forces of the russian Federation could lead to a nuclear attack by putin with a 50% probability.
📍The Americans called Gerasimov, who says that in case of heavy losses they will use nuclear weapons when retreating from Kherson.
📍After that, the russians had a kind of security guarantee and went to the left bank, having moved all their equipment and personnel.
📍The American fear of nuclear weapons forced the Ukrainian armed forces to refrain from attacks, after which the russians quietly retreated, keeping 30 thousand soldiers and equipment.

The author of the book claims that the Americans’ fear of nuclear weapons forced the armed forces to simply wait, which allowed the russian Federation to preserve its forces, regroup and seize large areas of Ukraine.

https://x.com/jurgen_nauditt/status/1877736798064968072

!

10,574 posted on 01/11/2025 1:35:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10573 | View Replies]

1,570 i.e. more than 1.09 Russians and Norks/min


10,575 posted on 01/11/2025 1:41:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10546 | View Replies]

To: PIF
Кремлевская табакерка

Denmark will not protect Greenland from Trump, but there is a nuance There is a great deal of excitement in the world around Donald Trump's very frank statements regarding the purchase of Greenland. The other day, Politico admitted that Denmark will not be able to prevent Greenland from joining the United States due to its support for Ukraine. This is true in military terms, although Denmark would not have enough resources to protect the giant island without helping Ukraine.

What is important to us is something else - Denmark is a member of NATO. And what is more important to us is that Trump is provoking a conflict within NATO. Very good!

At the same time, we should not forget that Greenland is the gateway to the Arctic. If the United States really gains control over the island, this will have far-reaching problems. In particular, the strengthening of the US military presence in the Arctic, which creates new risks for us. Russia invests heavily in the region; it was not for nothing that they sent the most experienced statesman Nikolai Patrushev to deal with the Arctic . As far as we know, there are already the first excellent results. We believe that there will be more soon.

The best option for us is if a real military conflict, or at least a hybrid one, starts between Denmark and the US. Any tension between NATO members will give us an opportunity to strengthen ourselves in the Arctic, and will certainly distract the West from helping Ukraine.

https://t.me/kremlin_secrets/5152

10,576 posted on 01/11/2025 2:22:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10574 | View Replies]

The number of vessels hit by sanctions has surpassed 1,000 with data from S&P Global Market Intelligence showing that more 800 of these ships do not have confirmed insurance. Moreover, the average age of sanctioned ships – 21 years – is some eight years older than the global average, adding to growing concern that the sprawling so-called shadow fleet could lead to multiple costly environmental catastrophes.
Despite slowing, the grey fleet is still growing by around 10 tankers a month, according to brokers BRS. Nearly two in three vintage tankers carried Iranian, Venezuelan, or Russian cargoes last year, according to estimates from broker Gibson.

https://splash247.com/audit-finds-more-than-80-of-sanctioned-ships-have-no-confirmed-insurance/

10,577 posted on 01/11/2025 3:17:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10576 | View Replies]

To: AdmSmith

Thanks JoeBiden! Putin loves you!


10,578 posted on 01/11/2025 4:50:15 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10574 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Chaos in Kursk: Desperate Russian Offensive Backfires! ]

Today [ Jan 10, 8 pm ], there are a lot of important updates from the Kursk direction.

Here, the Russian forces launched a bold mechanized assault toward Makhnovka, aiming to break through to Sudzha and disrupt critical Ukrainian logistics in the Kursk salient.

However, their predictable attack routes and limited local advantages were quickly countered by the rapid deployment of Ukrainian reserves from Sudzha, setting the stage for a decisive battle.

The goal of Russian forces in this area was to break through Sudzha’s defenses to the southeast and quickly cut off the eastern part of the town. By doing so, Russians would place all bridges in the town under their fire control, which would strain Ukrainian logistics in the whole of the Kursk salient and place the Ukrainian frontline positions at risk of collapse.

The new Ukrainian offensive in the Kursk region heavily depends on Sudzha as their main logistics hub, moving all their supplies, equipment, and ammunition through the town. To achieve their goal of cutting off the lifeblood of the Ukrainian offensive, the Russians launched a rapid mechanized assault towards the settlement of Makhnovka.

The main advantage of the Russian forces is the forests located around the area of the Russian-controlled settlement of Ulanok, which allows them to accumulate forces for the assault, virtually without detection by Ukrainian drone reconnaissance.

This also means that Ukrainian drone operators and artillery crews are not able to effectively target Russian troops and equipment, as they have effective concealment.

Furthermore, the left flank of the Russian forces is protected by the Sudzha and Psel rivers, preventing the Ukrainians from conducting a counterattack into the Russian flank. While the rivers themselves are narrow, the surrounding area is covered in marshes and mud, which slows down and complicates any movement of soldiers and vehicles, making a Ukrainian flank attack very difficult to conduct.

However, the main advantage of Ukrainian forces was the proximity of Sudzha as their main logistical base, which meant that the Ukrainian forces held a lot of reserve soldiers and heavy equipment within the town.

Furthermore, the infrastructure and size of Sudzha meant that Ukrainians could accumulate more forces in the town than Russians could within nearby villages and forests, severely outnumbering them. Combat footage from the area shows the quick deployment of Ukrainian armored vehicles from Sudzha to nearby Makhnovka, which is just two kilometers away, meaning that Ukrainian fighters were able to counter Russian attacks almost immediately.

Furthermore, the Russian attack route was very predictable as there was only one logical vector of advance that their mechanized forces could take. The dense forest cover, combined with terrain limitations enforced by the nearby river, marshes, and tree lines, forced the Russians to advance along the narrow corridor in the fields near Cherkasskaya Konopelka.

Combat footage from the area reveals how Ukrainians detected a group of several armored vehicles advancing towards Makhnovka along the expected route of attack. Immediately, a Ukrainian tank was dispatched to fire on the Russian vehicles and eliminate the Russian attack. This forced the Russian stormtroopers to dismount and flee towards nearby houses and forest belts in disorganization.

Subsequently, Ukrainian drone operators relayed coordinates of their presence to artillery crews, which immediately fired cluster munitions over the Russian positions, inflicting tremendous losses. The remaining Russian survivors were then subsequently caught and eliminated by Ukrainian FPV drones.

Occasionally, Russian infantrymen concealed in the forests to the south, managed to reinforce Russian forces maintaining a presence in southern Makhnovka. However, they often get detected as soon as they move into the village, becoming subjected to intense precision fire.

Combat footage from the area reveals how a squad of 8 Russian soldiers entered a house on the southern outskirts, which was subsequently struck by FPV kamikaze drones.

Overall, the Russians launched a daring, yet predictable, assault towards Makhnovka, intending to enter Sudzha and block Ukrainian logistics, only to be stopped at the southern part of the village by the swift reaction of Ukrainian forces.

Their inability to breach Ukrainian defenses will secure Ukrainian logistics for their offensive, forcing Russians to adopt increasingly desperate measures to try and halt the Ukrainian advance.


10,579 posted on 01/11/2025 4:50:39 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10572 | View Replies]

To: PIF
Thanks JoeBiden! Putin loves you!


10,580 posted on 01/11/2025 5:21:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10578 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,541-10,56010,561-10,58010,581-10,600 ... 22,101-22,114 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson