Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,401-10,42010,421-10,44010,441-10,460 ... 20,261-20,274 next last
To: PIF

End of Ukraine gas transit has no effect on EU energy market stability, European Commission says
https://kyivindependent.com/end-of-ukraine-gas-transit-deal-has-no-effect-on-eu-energy-market-stability-european-commission-says/

“The EU energy market remains stable following the end of the Russian gas transit through Ukraine, European Commission spokesperson Anna-Kaisa Itkonen said at a briefing in Brussels on Jan. 6...

...”We have been working intensely for over a year with our member states and with Ukraine as well to prepare in advance for this scenario,” the spokesperson said.

When asked about whether such a move caused any kind of emergency in Slovakia, she said that the Gas Coordination Group held talks last week and concluded that “there are no supply security issues or concerns for the European Union following the end of the transit.”

“The markets had already factored in at the end of transit agreement. And we have not seen price spikes in the new year,” Itkonen added...

...In his New Year’s address, (Slovak Prime Minister) Fico said that stopping Russian gas transit through Ukraine would have “radical consequences” for everyone in the European Union, but not for Russia. Fico claimed that gas and electricity prices in Europe would rise.”

Goes to show how full of BS these Russian agents are. More long term losses of market share for Russia (Austria, Slovakia and part of Hungary), with none of the drama threatened by Russian stooges. Only one natural gas pipeline remains active from Russia to Europe - the lowest capacity one (a single line of TurkStream), out of all the pipelines that existed before Putin’s disastrous 2022 full scale invasion attempt in Ukraine.

Putin is scrapping Russia’s economic prospects, as well as its inheritance of old Soviet Military equipment, at historic speed.


10,421 posted on 01/06/2025 6:17:19 PM PST by BeauBo
[ Post Reply | Private Reply | To 10324 | View Replies]

To: AdmSmith

‘Putin is afraid of Trump’s administration’ – Estonian foreign minister on potential Russia-Ukraine negotiations

Interview with Kyiv Independent’s Francis Farrell, January 6, 2025:

“Ukrainians are not fighting only for themselves and for us, but instead of us.

I (Margus Tsahkna) can say it as a former (Estonian) defense minister, because we saw in 2016-17, on the other side of our own borders, 120,000 (Russian) troops ready to go within 48 hours.

These troops do not exist anymore. They were sent to Ukraine. They are dead.


10,422 posted on 01/06/2025 7:32:12 PM PST by BeauBo
[ Post Reply | Private Reply | To 10402 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, January 6, 2025

Russian machine guns and small arms manufacturer Degtyaryev Plant recently filed its second multimillion-ruble lawsuit against the Russian Ministry of Defense (MoD). Russian state news outlet TASS reviewed case materials showing that the Degtyaryev Plant filed a lawsuit against the Russian MoD for over 100 million rubles (about $930,000) for an unspecified reason.[82] TASS noted that the Degtyaryev Plant won a case against the Russian MoD for about 100.5 million rubles (about $934,000) in December 2024 in its first lawsuit but that the details are unknown.[83] Russian authorities have arrested multiple high-ranking Russian MoD officials, including those responsible for defense procurement and logistics, on charges of bribery and embezzlement in recent months.[84]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-6-2025


10,423 posted on 01/06/2025 10:10:24 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10356 | View Replies]

To: FtrPilot; BeauBo

Murder Hornet Nickname For F/A-18s Equipped With Nine Air-To-Air Missiles Now Official
The Murder Hornet configuration that includes five AIM-120s and four AIM-9Xs made its combat debut over the Red Sea last year.
https://www.twz.com/air/murder-hornet-nickname-for-f-a-18s-equipped-with-nine-air-to-air-missiles-now-official


Our Best Look So Far Inside Israel’s Once Secretive 707 Tankers
The Israeli Air Force provided unprecedented access to the rarely seen Remote Vision System refueling aid used in its 707 tankers.
https://www.twz.com/air/our-best-look-so-far-inside-israelis-once-secretive-707-tankers


Ukraine Launches New Offensive In Russia’s Kursk Region
With Trump just weeks away from taking office and negotiations potentially on the horizon, both sides are scrambling to snap up territory.
https://www.twz.com/news-features/ukraine-launches-new-offensive-in-russias-kursk-region


Red Sea Attacks Are Testing Combat Information Centers Aboard U.S. Navy Warships Like Never Before
The chaotic, high-risk nature of the grinding Red Sea fight was starkly illustrated when a Navy cruiser shot down a friendly Super Hornet last month.
https://www.twz.com/news-features/red-sea-attacks-are-testing-combat-information-centers-aboard-u-s-navy-warships-like-never-before


Taiwan Coast Guard Blames Chinese-Owned Ship For Cutting Undersea Communications Cable
Taiwan has seen multiple incidents of damage to its underwater infrastructure in recent years, with China widely suspected of being the culprit.
https://www.twz.com/news-features/taiwan-coast-guard-blames-chinese-owned-ship-for-cutting-undersea-communications-cable


10,424 posted on 01/07/2025 5:18:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10327 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Combat Bathtub VS Ukrainian AZOV. ]

Today [ Jan 06, 8 pm ], there are a lot of updates from the direction of Toretsk.

Here, after the previous failed Russian assault, Ukrainians prepared for a swift and decisive counterattack to exploit the disarray among the retreating Russian forces.

With Russian survivors left scattered and unsupported, the stage was set for the Ukrainian Azov brigade to dismantle their positions and prevent any chance of renewed offensives.

The main Ukrainian goal was to conduct a follow-up counterattack to eliminate the remaining Russian forces scattered throughout the settlements, as remnants after their latest failed assault.

Despite being in an unorganized state, these Russian survivors posed a continued threat to the Ukrainians, as at any time, they could reorganize themselves for a renewed attack on the southern flank of Toretsk. To prevent the Russian forces from launching such a follow-up operation, Ukrainian commanders decided to launch direct assaults, to clear the enemy out while they were still unprepared.

To achieve their goal, Ukrainians conducted a series of clearing operations with infantry, because even though tank raids can deal significant damage, they may leave some survivors hiding in the basements, who can communicate with each other and accumulate.

Ukrainians achieved this by deploying soldiers to conduct close-quarters combat to discover and eliminate Russian positions in narrow residential areas and basements.

The residential area Russians took up positions in, allowed the Russian forces around 300 houses, allowing them to disperse their stormtroopers widely. The concealment provided by the houses and their basements hampers Ukrainian drone reconnaissance, making it difficult to detect and track the troops once scattered.

The primary danger lies in the Russians using these basements as concealed positions to ambush Ukrainian infantry from unexpected locations during clearing operations.

However, Russian forces were largely left in a disorganized state, due to the heavy losses suffered during their latest attack on the southern flank. With Ukrainians deploying skilled sniper teams to deny the Russians free movement in between the houses, Russian soldiers knew that venturing into the open would almost certainly result in death.

The suppression and disarray of the Russian forces allowed the Ukrainians to establish effective fire control over the area, with Ukrainian snipers and drone operators systematically eliminating any Russian soldiers who exposed themselves out in the open, picking them off one by one.

This enabled the Ukrainian 12th Special Purpose Brigade Azov to launch well-coordinated counterattacks toward Nelipivka, deploying infantry squads to target isolated Russian units entrenched in houses and basements. Combat footage highlights the elite brigade’s soldiers’ methodical approach, advancing cautiously to neutralize Russian positions.

They effectively suppressed and disoriented the Russian defenders by throwing hand grenades into the basements and buildings they were hiding in, creating opportunities to breach their strongholds. Capitalizing on the ensuing chaos, the Ukrainian troops swiftly raided the basements, successfully eliminating resistance and capturing the remaining Russian fighters.

Furthermore, the Russian forces in this sector lacked adequate transport vehicles, further compounding the plight of their isolated units, as they could not receive essential ammunition and supplies. Ukrainian fire control, reinforced by precision drone strikes, not only disrupted resupply efforts, but also prevented any attempts to reinforce the village with additional resources.

This exacerbated the already dire logistical challenges faced by the Russians, leaving their units increasingly vulnerable and under-equipped.

Combat footage released by Russian fighters in the area shows the state of Russian logistics is extremely dire, to the point where the Russian soldiers are forced to improvise by attaching bathtubs to their motorcycles to carry supplies in.

Furthermore, another geolocated video shows how Russians were using golf carts, and even electric scooters to transport their soldiers and supplies to the village, which were, of course, instantly destroyed by Ukrainian kamikaze drones.

Overall, the failure of the previous Russian attacks and a lack of logistics vehicles and reinforcements, established perfect conditions for a successful Ukrainian counterattack that cleared the Russian presence from the settlements.

The Russian use of improvised civilian vehicles is a stark sign of the rising issues as armored vehicles are becoming becoming fewer and more scarce among Russian forces, due to high losses in suicidal assaults in the past

This development gradually renders them incapable of conducting large offensive maneuvers and exposes further weaknesses for Ukrainians to exploit.


10,425 posted on 01/07/2025 5:57:23 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10423 | View Replies]

To: BeauBo
China may be delaying the funding of the Power of Siberia 2 Pipeline, simply because they can easily see that their leverage to drive a rapacious deal is likely to increase sharply, as Russia becomes more economically desperate through 2025 - just waiting for the fire sale.

I am very intrigued by such a massive project - Power of Siberia 2. IIRC this pipeline will draw from Russian gas fields that are to the west from the first gas pipeline to China. Further away too. #2 will be more ambitious with a larger diameter. Putin's - Rooski land is strapped for funds these days. So is unable to finance their share of funding it. Rooski interest rates are sky high, no European banks will help them out. Especially the traitorous German ones, that have invested in Rooski oil-gas projects in the past.

10,426 posted on 01/07/2025 6:09:19 AM PST by dennisw
[ Post Reply | Private Reply | To 10397 | View Replies]

To: PIF

Most likely, the Murder Hornet will be used for fleet defense against anti-ship cruise missiles/drones.

10,427 posted on 01/07/2025 6:20:11 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10424 | View Replies]

To: BeauBo
...200 Ukrainian pilots had graduated from the UK’s F-16 basic course.

These numbers don't add up.

Typical manning for pilots would be 1.5 to 2.5 pilots per UE (Unit Equipped) aircraft.

If Ukraine Air Force has 200 F-16 pilots, it would be impossible to keep them current/proficient.

My guess is that 200 would include pilots & maintenance personnel.

10,428 posted on 01/07/2025 6:24:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10420 | View Replies]

To: PIF

Our Best Look So Far Inside Israel’s Once Secretive 707 Tankers
The Israeli Air Force provided unprecedented access to the rarely seen Remote Vision System refueling aid used in its 707 tankers.
https://www.twz.com/air/our-best-look-so-far-inside-israelis-once-secretive-707-tankers
____________

Those 707 tankers are ancient. Israel has requested newer ones from the USA.
As usual, Israel has upgraded these 707s, same with all warplanes from the US. The main upgrades are with special Israeli electronics, computers, software. They/IAF even have gotten our F-35s to perform much better, used them to attack Iran last month. To take out Rooski crappy s300 air defense via standoff missile fire.

“In the context of the recent Israeli attack on Iran using F-35s, the term “standoff” refers to a military tactic where weapons are launched from a distance, outside the range of enemy defenses. This approach allows attacking forces to strike targets while minimizing their own risk of being hit.”


10,429 posted on 01/07/2025 6:36:07 AM PST by dennisw
[ Post Reply | Private Reply | To 10424 | View Replies]

To: FtrPilot

Here is the article that I saw: https://united24media.com/latest-news/200-ukrainian-pilots-complete-f-16-training-in-the-uk-4832

I am not familiar with the source, and did not check it. It could be that the reporter conflated support personnel with pilots out of ignorance (not uncommon for reporters), or deliberately, to promote a psyop objective.

Alternatively, perhaps this 200 number, if pilots, might represent the total number across several classes, who had passed the introductory phase of training, and were spread at different points along the training pipeline.

I have lost track of how many F-16s Ukraine has now received, but the article we were commenting on earlier in this discussion said “dozens”. Somewhere between 6 and 7 dozen aircraft, with 2.5 pilots each, would be 200 pilots. Nonetheless, additional pilots are also being trained in other countries, so it seems unlikely that 200 UK trained pilots are in the cockpits of operational Ukrainian fighters.

So perhaps the report of 200 UK graduates conflated pilots with maintainers, perhaps they are spread in the lengthy pipeline, or both.

In any event, it seems that we are past the initial onesy/twosey phase of providing F16s and pilots to Ukraine, and starting to build some serious force structure.


10,430 posted on 01/07/2025 7:25:28 AM PST by BeauBo
[ Post Reply | Private Reply | To 10428 | View Replies]

To: dennisw

Power of Siberia 2 Would carry some of the gas from the big fields that used to fill pipelines to Europe, that now have no way to market. However, it would have to traverse thousands of miles of tundra, where no road yet exists, and would require building a raised berm above permafrost, that can melt into swamp on occasion. Not quick, and not cheap.

China has big programs to increase coal, nuclear and solar.


10,431 posted on 01/07/2025 7:36:36 AM PST by BeauBo
[ Post Reply | Private Reply | To 10426 | View Replies]

To: BeauBo
"...I have lost track of how many F-16s Ukraine has now received..."

My guess is that Ukranian Air Force has shut down any announcements WRT delivery of F-16s to Ukraine.

The number of F-16s delivered and their basing should be kept from ruzzia.

Meanwhile, here's a success story:

https://x.com/DefenceU/status/1876580538934345854

According to verified data, on December 13, 2024, for the first time ever, our F-16 pilot shot down six cruise missiles. He used four air-to-air missiles and the fighter’s cannon to accomplish this unprecedented feat.

ruzzia must have fired all of these cruise missiles at the same target attempting to saturate air defense.

My guess is the target was an airfield where some of the F-16s are stationed.

Hopefully, we will see the gun camera video in the near future.

10,432 posted on 01/07/2025 7:46:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10430 | View Replies]

To: FtrPilot

“F-16 pilot shot down six cruise missiles”

Getting the hang of it!

Anything you practice, you get good at.


10,433 posted on 01/07/2025 8:42:23 AM PST by BeauBo
[ Post Reply | Private Reply | To 10432 | View Replies]

To: BeauBo

More on Power of Siberia 2 via Perplexity >>>>>

The major Russian gas fields that previously supplied Europe and are now targeted for export to China via the proposed Power of Siberia 2 pipeline are primarily located in Western Siberia, specifically in the Yamal Peninsula region.

Location of Key Russian Gas Fields
The Yamal Peninsula in Western Siberia contains several of Russia’s largest natural gas fields:

Bovanenkovo: One of the largest fields, with recoverable reserves of 4,000 km³7
Kharasaveyskoye: Another significant field in the Yamal region7
Urengoy: Russia’s second-largest gas field, located south of Yamal7
Yamburg: The third-largest Russian gas field, also in the Yamal-Nenets region7

These fields were originally developed to supply gas to European markets. However, with the shift in Russia’s export strategy following geopolitical tensions, they are now being considered as sources for the Power of Siberia 2 pipeline to China.

More>>> https://www.perplexity.ai/search/gas-from-the-big-russian-field-Clkk9tJmR9SnjqybgjDwZw


10,434 posted on 01/07/2025 8:52:09 AM PST by dennisw
[ Post Reply | Private Reply | To 10431 | View Replies]

To: BeauBo

>>>>>>> Look what Tsar wannabee Putin blundered his way into with his Ukraine war. Building a new gas pipeline to China, that is more than twice as long as the Nordstream into Europe. Worse, the Chinese will never pay what extortionate prices Germany + Europe were paying for Rooski Nordsteam 2 gas.

Map to where Yamal Peninsula, Russia is https://www.bing.com/maps?q=Yamal+Peninsula&FORM=HDRSC6&cp=55.202172%7E78.080943&lvl=2.4

________

The distances from the Yamal Peninsula gas fields to St. Petersburg and the closest point in China are significantly different:

Distance to St. Petersburg
The approximate distance from the Yamal Peninsula to St. Petersburg is 1,500 miles.

Distance to China
The distance from the Yamal Peninsula to the closest point in China via pipeline is approximately 3,728 miles3.

Comparison
The distance to China is more than twice the distance to St. Petersburg. This significant difference in distance has important implications for gas transportation and infrastructure development:


10,435 posted on 01/07/2025 9:00:50 AM PST by dennisw
[ Post Reply | Private Reply | To 10431 | View Replies]

To: dennisw

I did maintenance on Kc-135s for almost 40 years they me be “ancient” in terms of manufacture date, but when it comes to modernization , avionics, engines, brakes…. They are pretty modern and reliable unlike its “replacement “


10,436 posted on 01/07/2025 9:10:31 AM PST by blitz128
[ Post Reply | Private Reply | To 10429 | View Replies]

To: BeauBo

Figured that is what they would be doing rather than complex multiship operations

That will come with time, right now shooting down Russian GDP is more important


10,437 posted on 01/07/2025 9:12:55 AM PST by blitz128
[ Post Reply | Private Reply | To 10433 | View Replies]

To: BeauBo

My guess if it is ever built it will be more to an a decade from now, putin needs the cash now


10,438 posted on 01/07/2025 9:13:45 AM PST by blitz128
[ Post Reply | Private Reply | To 10431 | View Replies]

To: PIF
Puto-Fascist Christmas today, in captive Russia:

Russian Patriarch Kirill bashes West during Orthodox Christmas celebrations

"Moscow Patriarch Kirill accused the West of "hating" Russia because it represents "an alternative path of civilizational development." He made the comments during the celebration of the Christmas Mass on Jan. 7.

Patriarch Kirill (born Vladimir Gundyayev in Leningrad, classified as a KGB agent by the federal police of Switzerland since 1970, operating under the code name Mikhaïlov) has been a close ally of Russian President Vladimir Putin, praising his rule as a "gift from God" and publicly supporting the war against Ukraine, subsequently straining relations with other Orthodox churches (and polite society worldwide)...

...Orthodox Christians in Russia celebrate Christmas on Jan. 7 in accordance with the Julian calendar. In 2023, Ukraine signed a law moving the day of Christmas celebrations to Dec. 25, similar to Western Christianity.

During the mass, Kirill blessed icons and crosses that were engraved with Putin's initials (not the old "JC" or "INRI" of the Western Churches) and will be sent to Russian soldiers fighting in Ukraine, Kremlin spokesperson Dmitry Peskov told the Russian media...

...Ukraine placed Kirill on its wanted list in December 2023 after accusing him of infringing on Ukraine's territorial integrity resulting in "the death of people or other serious consequences." The charge carries a punishment of life imprisonment."


10,439 posted on 01/07/2025 9:16:38 AM PST by BeauBo
[ Post Reply | Private Reply | To 10425 | View Replies]

To: dennisw

The Yamal area (the Peninsula, surrounding waters and a bit to the South) produces (produced) more than 70% of Russia’s natural gas.

It has harsh Arctic conditions. “Yamal” literally translates as the end of the land. Nothing else but some reindeer herders.

There is vast, undeveloped and uninhabited wasteland between those gas deposits and China.


10,440 posted on 01/07/2025 9:25:12 AM PST by BeauBo
[ Post Reply | Private Reply | To 10434 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,401-10,42010,421-10,44010,441-10,460 ... 20,261-20,274 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson