Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,061-10,08010,081-10,10010,101-10,120 ... 22,141 next last
To: AdmSmith

Russian hybrid war tactics must be effectively deterred. The price must be too high to pay.

“Tanker Eagle S Seized by Finland for Severing Cables Between Finland & Estonia”

German Foreign Minister Annalena Baerbock has raised concerns about Russia’s so-called “shadow fleet” following recent damage to undersea cables across Europe.

“Almost every month, ships are currently damaging important undersea cables in the Baltic Sea,” Baerbock told Germany’s Funke media group on Dec. 28. She described suspicious activities by ship crews, including dropping anchors and dragging them along the seabed for kilometers without explanation.

“Ship crews lower anchors into the water, drag them for kilometers across the seabed for no apparent reason, and then lose them when they pull them up,” she said.

Baerbock expressed doubt that the string of incidents over recent months could be coincidental. “This is an urgent wake-up call for all of us. In a digitalized world, undersea cables are the communication arteries that hold our world together,” she stressed, urging stronger sanctions against Russia and increased investment in national security.”


10,081 posted on 12/29/2024 11:02:03 AM PST by BeauBo
[ Post Reply | Private Reply | To 10077 | View Replies]

To: gleeaikin

US icebreakers apparently are only able to cut 3 ft. ice at that speed

The US has one, the Polar Star, diesel-electric, built 1978. One. Held together with spit, bailing wire, and duct tape. Literally. Capable of breaking 6 ft thick ice at 3.5 mph.

Russia has 8 nuclear powered heavy ice breakers - they feature 2 reactors, 2 or more shafts, saunas, heated pools, squash courts.

3 of the newer ones:
Yakutiya, built 2024, is designed to be 9 ft thick level ice at a continuous speed of 1.7–2.3 mph at full power when operating in deep water at design draught.

Arktika, built 2020, same ice specs

50 Let Pobedy, built 1989, designed to break through ice up to 8.2 ft thick at speed.


10,082 posted on 12/29/2024 11:05:15 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10076 | View Replies]

To: AdmSmith

translation:
Comrade Kim Jong-un said that the Russian authorities are continuing terrorist acts by deliberately attacking homes, hospitals, clinics, stores, public gatherings, and places of rest, and that if the Russian authorities continue to pursue such a course, they will face a stronger counterattack.


10,083 posted on 12/29/2024 11:06:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10080 | View Replies]

To: PIF

;-)


10,084 posted on 12/29/2024 2:32:08 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10083 | View Replies]

To: gleeaikin

The fact that they sent river water class ships into the above let alone Black Sea is important and speaks to lack of capability.

The fact that the usuals down play this just shows lack of credibility


10,085 posted on 12/29/2024 5:11:17 PM PST by blitz128
[ Post Reply | Private Reply | To 10076 | View Replies]

To: FtrPilot

Kyiv Independent reports on the rumored peace proposals from Trump’s team:

“Russia is dissatisfied with the reported peace deal proposals on Ukraine from U.S. President-elect Donald Trump’s team, Russian Foreign Minister Sergey Lavrov said on Dec. 29, according to state-owned TASS.

Earlier reports from the Wall Street Journal indicated that Trump’s team is considering a plan to delay Ukraine’s NATO membership by at least 20 years in exchange for continued Western arms supplies and the deployment of European peacekeepers to monitor a ceasefire.

Lavrov said the proposal, as outlined in leaks and Trump’s Dec. 12 Time interview, suggests “freezing hostilities along the current line of contact and transferring the responsibility of confronting Russia to Europe.”

“We are certainly not satisfied with the proposals sounding on behalf of representatives of the president-elect’s team,” Lavrov said, specifically rejecting the idea of introducing European peacekeepers in Ukraine.

Reports suggest that Trump discussed these ideas during a Dec. 7 meeting in Paris with Ukrainian President Volodymyr Zelensky and French President Emmanuel Macron. Trump reportedly emphasized Europe’s need to take the lead in deterring Russian aggression.”


10,086 posted on 12/29/2024 6:30:54 PM PST by BeauBo
[ Post Reply | Private Reply | To 10078 | View Replies]

To: BeauBo
specifically rejecting the idea of introducing European peacekeepers in Ukraine.

The first rule of Frozen Conflict Club is "All peacekeepers must be Russian".

10,087 posted on 12/29/2024 8:30:53 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 10086 | View Replies]

To: ETCM

Russia has got to want it more.

That is what it will take, because they are the ones making the problem.

Bring the pain, and take away the money, to set conditions for a deal.


10,088 posted on 12/30/2024 12:59:04 AM PST by BeauBo
[ Post Reply | Private Reply | To 10087 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, December 29, 2024

Azerbaijani President Ilham Aliyev accused Russia of shooting the Azerbaijan Airlines Embraer 190 passenger flight over the Republic of Chechnya on December 25 and of attempting to cover up Russia's responsibility for the plane's crash in Kazakhstan — effectively rejecting Russian President Vladimir Putin's lackluster apology. Aliyev gave an interview to Azerbaijani TV published on December 29 in which he rejected Russian officials’ theories that a bird strike and a gas cylinder explosion caused the crash.[14] Aliyev noted that preliminary information clearly indicated that the aircraft sustained damage from ground-based fire near Grozny, Chechnya and that Russian electronic warfare (EW) systems made the plane uncontrollable.[15] Aliyev also stated that Russia introduced an emergency airspace closure in Grozny only after striking the aircraft, and Aliyev suggested that this was part of Russian local authorities’ attempts to conceal Russia's responsibility for the crash. Aliyev noted that Russia also pushed for the Interstate Aviation Committee, which he alleged is composed of mostly Russian officials and citizens, to conduct the investigation into the crash in order to further cover up Russia's involvement in the crash. Aliyev noted that Azerbaijan refused investigative assistance from this committee due its lack of objectivity. Aliyev’s interview follows Putin's vague apology to Aliyev on December 28, in which Putin did not directly admit Russia's culpability in the crash and simply stated that a “tragic accident” occurred in Russian air space.[16] Aliyev publicly reiterated the demands he reportedly made to Putin on December 27: the Kremlin must apologize to Azerbaijan, admit its culpability, punish the guilty parties, and pay compensation to Azerbaijani passengers and crew. Putin reportedly once again called Aliyev on December 29 to discuss the crash, but neither party offered a complete read out of the interaction.[17] The timing of the publication of Aliyev’s interview and official statements about Putin's call to Aliyev suggests that Putin may have called Aliyev following the interview's publication and that the call likely concerned Aliyev’s public accusations and demands.

The US delivered its first liquified natural gas (LNG) shipment to Ukraine on December 27. Ukraine's largest private energy company DTEK announced on December 27 that the LNG delivery consists of approximately 100 million cubic meters of gas and represents Kyiv’s first direct LNG purchase from the US.[21] The US LNG shipment is part of a broader agreement between DTEK and US company Venture Global to supply Ukraine with US LNG that extends through 2026 and an additional 20-year LNG purchase agreement.[22] Ukraine stopped purchasing Russian gas in November 2015, though Ukraine continues to transport Russian gas to other European customers through Ukrainian gas pipelines - an important source of revenue for Ukraine.[23] Russia's and Ukraine's current gas transportation contract will expire at the end of December 31, 2024, and it remains unclear whether or when Russia and Ukraine may renew the contract. This US LNG delivery marks Ukraine's latest effort to offset Russia's weaponization of energy exports and solidify Ukraine's energy independence from Moscow.

Russia reportedly continues to face labor shortages that Russian military recruitment and persistent demographic problems are likely exacerbating. Ukraine's Foreign Intelligence Service (SZRU) reported on December 27 that Russian labor shortage amounts to about 1.5 million people with an unemployment rate of 2.3 percent.[80] The SZRU noted that the Russian labor force decreased by one million people between 2022 and 2024 and is currently about 76.3 million people. The SZRU reported that Russia is experiencing the most acute labor shortages among people aged 19 to 40 and in the IT and retail sectors. The SZRU added that there is a labor shortage of 400,000 people in the construction sector and assessed that Russian labor shortages will increase to four million people by 2030 due to the ongoing Russian war effort in Ukraine and restrictive migration policies.

Ukrainian Deputy Tamila Tasheva reported on December 29 that Crimean occupation officials have conscripted 50,000 Crimeans since either 2014 or 2015 and have mobilized several thousand Crimeans since 2022.[81]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-29-2024

10,089 posted on 12/30/2024 2:24:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10056 | View Replies]


10,090 posted on 12/30/2024 2:25:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10058 | View Replies]

2,010 i.e. more than 1.39 Russians and Norks/min


The record is 2,200 29DEC2024

10,091 posted on 12/30/2024 2:40:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10059 | View Replies]

To: BeauBo
This clip with millions of hits in China calls for China to take over Siberia, Lake Baikal, Sakhalin and other parts of Russia after it loses in Ukraine then falls apart. “The UN Charter will be a piece of junk, time for China to re-write the international law and order”

https://x.com/bxieus/status/1873390350553026980
1 min video

10,092 posted on 12/30/2024 2:55:26 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10088 | View Replies]

https://x.com/Q0MT6pFmbVqynsM/status/1873664927480922188

but, it will continue to oscillate, here is the latest https://www.investing.com/currencies/usd-rub

10,093 posted on 12/30/2024 3:13:33 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10092 | View Replies]

To: blitz128

Above =azov


10,094 posted on 12/30/2024 4:14:23 AM PST by blitz128
[ Post Reply | Private Reply | To 10085 | View Replies]

To: AdmSmith

Has been my prediction, and there is nothing short of nuclear war that can stop China
Not good but FAFO


10,095 posted on 12/30/2024 4:17:24 AM PST by blitz128
[ Post Reply | Private Reply | To 10092 | View Replies]

To: ETCM

Putin’s dream of an expanded Russia and return to power on the world stage had turned into an existential threat to his existence.

For putin there is only one path, it is up to Russians to demand another path.


10,096 posted on 12/30/2024 4:21:22 AM PST by blitz128
[ Post Reply | Private Reply | To 10087 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian BTRs Roll Over & Fall in a Ditch During The Attack ]

Today [ Dec 29, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, after securing a bridgehead from previous North Korean attacks, the main Russian forces initiated a decisive counterattack meant to collapse the main Ukrainian defenses in front of Malaya Loknya.

However, a lack of the element of surprise and overconfidence in their mechanized units among Russians, led to a disastrous outcome as the Ukrainians readily engaged them.

The Russian objective, supported by North Korean troops, is to capture Novoivanovka, a key Ukrainian stronghold that has withstood Russian assaults for over 2 months. To break its defenses, Russian forces launched a flanking maneuver to sever the village’s supply route, aiming to force a Ukrainian withdrawal.

Success here would allow them to bypass the primary Ukrainian defenses and pave the way for a direct assault on Malaya Loknya.

The Russian operation was made possible by North Korean control of the tactically vital forests near Kruglenkoe, north of Novoivanovka. Faced with the futility of direct attacks, Russian generals opted to leverage the high ground near Kruglenkoe, secured by North Koreans, to outflank Novoivanovka’s defenses from the north.

A topographic map reveals that Russian positions north of Novoivanovka are situated on higher ground, giving them a significant tactical advantage.

The Ukrainian forces, positioned in the lowlands, lacked fire control over the advancing Russian mechanized units, as these units remained outside their field of view. This elevation disparity enabled the Russians to advance swiftly toward the road, unimpeded by crossfire, until reaching the same level as the Ukrainian defenders.

However, unlike the frontal assaults at Novoivanovka, Russian forces near Kruglenke are hindered by the need to traverse dirt roads or open fields, slowing their vehicles significantly on rough terrain.

Compounding these tactical disadvantages, earlier North Korean assaults eliminated any chance of surprise, prompting Ukrainian drone operators to closely monitor the area for further attacks. Additionally, Ukrainian forces had artillery batteries and anti-tank missile posts strategically positioned and ready to repel the advancing Russians.

The Ukrainians’ primary defensive advantage lies in their stable positions in Novoivanovka, Leonidovka, and Malaya Loknya, which enable effective counterattacks against Russian forces attempting to secure the Malaya Loknya-Novoivanovka road.

With fire control over this narrow corridor, Ukrainian defenders can inflict heavy losses on the Russian assault units, and then mobilize troops from nearby settlements to eliminate any remaining Russian presence around the road.

Combat footage from the area reveals how the Russians tried to deploy their stormtroopers on board BTR-82A armored transport vehicles at tree lines near the main road after they managed to move down from the higher elevations, with almost no resistance until that point.

However, once the Russian column reached the road and stopped to dismount their stormtroopers, they quickly became vulnerable to Ukrainian fire from the positions to the south of the road, which is situated at the same elevation, which allowed them to effectively target the Russian forces.

The Russian vehicles found themselves within the two-kilometer range of the Ukrainian anti-tank guided missiles in the area, which managed to effectively destroy the BTRs in coordination with drone strikes and artillery fire.

Once the Russian BTR crews realized what was going on, they attempted to drive away in panic, only to crash and roll over their vehicle. As the panic and disorganization spread among the Russian ranks, amidst the sudden Ukrainian fire, it only accelerated their defeat, as all of them got eliminated during their attempts to escape and survive.

Overall, the Russian attempt to sever the crucial logistics route between Novoivanovka and Malaya Loknya, to advance their offensive, ended in disaster. The assault was swiftly repelled, with Russian forces eliminated within minutes.

Their failure to secure this key road ensures continued Ukrainian use of it to maintain their defensive line at Novoivanovka. The Ukrainian preparedness and the failure of the initial attack will likely compel the Russians to restart their frontal assaults on Novoivanovka itself.


10,097 posted on 12/30/2024 4:35:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10086 | View Replies]

To: PIF

OT:
SpaceX Flight 7 will likely happen between Jan 10 - Jan 16


10,098 posted on 12/30/2024 5:02:31 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10097 | View Replies]

To: PIF

Is that the rescue mission


10,099 posted on 12/30/2024 5:06:10 AM PST by blitz128
[ Post Reply | Private Reply | To 10098 | View Replies]

To: AdmSmith

Significant drop in the ruble today (7 or 8%). It had been strengthening , all the way back to a penny on Christmas.

Maybe it will take some days or weeks for reporting to come out on what has triggered this drop.


10,100 posted on 12/30/2024 6:04:28 AM PST by BeauBo
[ Post Reply | Private Reply | To 10093 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,061-10,08010,081-10,10010,101-10,120 ... 22,141 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson