Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 09/04/2017 12:10:59 AM PDT by TigerLikesRooster
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021 next last
To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; endthematrix; ...
We will find out soon enough if this is for real.
2 posted on 09/04/2017 12:12:02 AM PDT by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster
Kimmy needs a MOAB headache, and a Cruise Missile enema. " To Pyongyang with ❤️ .... Signed, DJT"
4 posted on 09/04/2017 12:21:13 AM PDT by BigEdLB (To Dimwitocrats: We won. You lost. Get used to it.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

What is of supreme importance in war is to attack the enemy’s strategy. - Sun Tzu

What is of supreme importance in war is to know and understand the enemy’s strategy. - Ray76

Why does NK want us to strike them? What is their strategy?

Never do what your enemy desires, for this reason alone: that he desires it - Napoleon


5 posted on 09/04/2017 12:22:10 AM PDT by Ray76 (Republicans are a Democrat party front group.)
[ Post Reply | Private Reply | To 1 | View Replies ]

Curious to whom these audacious pronouncements are truly directed.


7 posted on 09/04/2017 12:24:44 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

North Korea obviously has a death wish.

I don’t know if we have a plan. Maybe it is to take a hit and then attack. Probably the most likely one we have.

When we attack wep must go all in. Beware of Russia and China.


12 posted on 09/04/2017 12:34:01 AM PDT by moviefan8
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

I’m guessing launch will generate a response.


26 posted on 09/04/2017 1:23:22 AM PDT by Reno89519 (Drain the Swamp is not party specific. Lyn' Ted is still a liar, Good riddance to him.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster
Some one rally wants war with the NORKs.
28 posted on 09/04/2017 1:34:50 AM PDT by mad_as_he$$ (Not my circus. Not my monkeys.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster
If Fat can't launch, he can't test.
34 posted on 09/04/2017 1:51:09 AM PDT by StAnDeliver (Prosecute the win. Run up the score.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

The CIA needs to launch a covert strike and give him the Russian flu.


40 posted on 09/04/2017 2:00:56 AM PDT by Jemian
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

800 billion a year for the military?
How many billions for our vaunted CIA?
Why doesn’t our military shoot any of these prior to leaving the pad?
Cause our military industrial complex needs a BOOGIE Man out there to continue the gravy train.
The fat little punk was seen by our satellites for an hour last big launch. Why wasn’t he taken out then?


45 posted on 09/04/2017 2:45:10 AM PDT by Joe Boucher (President Trump makes obammy look like the punk he is.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

I hate saying this , as I live in Japan , but it looks to me like Kim , if he pre-emptively sends a missile anywhere , it’ll be Japan first . US will retaliate in some way and in the process South Korea will most likely be taken out by the Norks . After that is anybody’s guess .


46 posted on 09/04/2017 2:47:06 AM PDT by sushiman (i)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

Was reported on the radio this morning here in northern Michigan.


53 posted on 09/04/2017 3:25:18 AM PDT by MarMema
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

If the US has a role in this quagmire, we should find a clandestine solution as opposed to a military one.


59 posted on 09/04/2017 3:55:41 AM PDT by Oldeconomybuyer (The problem with socialism is that you eventually run out of other people's money.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

Their immediate strategy is to develop an operational deterrent before we act. A later strategy will be to make demands or to launch a surprise attack, possibly as a coordinated move with China.


72 posted on 09/04/2017 5:22:55 AM PDT by Williams (Stop tolerating the intolerant.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

Be interesting if it takes out power on some island. Perhaps then our government will stop looking at EMPs as some creation of Art Bell and instead see them as the REAL THREAT they are.


87 posted on 09/04/2017 6:15:13 AM PDT by BobL (In Honor of the NeverTrumpers, I declare myself as FR's first 'Imitation NeverTrumper')
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

China:
The following censorship instructions, issued to the media by government authorities, have been leaked and distributed online. The name of the issuing body has been omitted to protect the source:

The article “North Korea announces: Kim Jong Un ordered a test of a hydrogen bomb. The test was successful” and all related news must close comments. All websites must not hype related topics

http://chinadigitaltimes.net/2017/09/minitrue-no-hyping-north-korea-nuclear-test/


90 posted on 09/04/2017 6:33:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

“might” indicates fake news.


97 posted on 09/04/2017 6:54:41 AM PDT by Rapscallion (Democrats are suffering Soros psychosis. He hates America.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

“might” indicates fake news.


99 posted on 09/04/2017 6:56:40 AM PDT by Rapscallion (Democrats are suffering Soros psychosis. He hates America.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

Wow. After 20 years of your excellent North Korea threads here on FR, TLR, they are FINALLY taking off, outside of just the regular usual 5 or 6 FR posters...with armchair generals and Korea Peninsula specialists galore!! Imagine THAT! ;-)


103 posted on 09/04/2017 7:08:01 AM PDT by AmericanInTokyo
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TigerLikesRooster

Last month, Trump said the now famous quote, “As I said, they will be met with fire, fury and frankly power the likes of which this world has never seen before.”

Lets look at that at face value. This rules out conventional and nuclear weaponry since the world has seen them in action before. What is left? Does the USAF have satellites orbiting the Earth? What is their weaponry? Laser? There has been numerous reports, over the last 20 years, of unknown high-altitude aircraft flying over the Southwest. What weaponry do these ‘black projects’ have? Would these be the source of the ‘fire and fury’ that Trump is hinting at?


115 posted on 09/04/2017 8:16:28 AM PDT by TMA62 (Al Sharpton - The North Korea of race relations)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson