Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

MEK Is Not Part of the Iranian Opposition!
Pajamas Media ^ | Jan. 20, 2011 | Manda Zand Ervin

Posted on 01/27/2011 5:57:42 AM PST by nuconvert

In recent reports, the Washington Times has misinformed the public about the Iranian group MEK. Here are the facts.

The Times foreign service reports that a group of prominent U.S. Republicans associated with homeland security just spoke to a forum of cheering Iranian exiles in Paris. The exiles demanded that the Obama administration remove the Mujaheddin-e Khalq (MEK) Iranian opposition group from the U.S. list of foreign terrorist organizations, and that the U.S. incorporate it into efforts to overturn the mullah-led government in Tehran. Former New York Mayor Rudolph Giuliani, former Secretary of Homeland Security Tom Ridge, former White House Homeland Security adviser Frances Fragos Townsend, and former Attorney General Michael Mukasey are the new batch of “formers” being recruited to lobby the Obama administration to support MEK.

MEK — which translates as “Jihadists of the Deprived Masses” — was one of the Middle Eastern anti-American groups sponsored and supported by the Soviet Union during the Cold War of the 1960s and 1970s. Led by Massoud Rajavi, MEK is a terrorist organization that robbed millions of dollars from banks and bombed public buildings and police stations. They killed thousands of innocents and law enforcement officials.

They bombed the offices of El Al, Shell, BP, and Jewish-owned offices in Tehran. They bombed numerous other U.S. facilities and properties, killing and maiming. In its publication, The Mojahid, Mr. Rajavi said: “We will make this another Vietnam for America.” During the 1970s, MEK assassinated many American military and civilian personnel, including: General Harold Price, Colonel Lewis L. Hawkins, Colonel Paul Schafer, and Colonel Jack Turner. Donald G. Smith, Robert R. Krongrad, and William C. Cottrell of Rockwell International were among the civilians assassinated by Rajavi’s order.

MEK also attempted to assassinate President Richard Nixon by bombing places he was going to visit when in Tehran. During the 1970s, there were many attempted kidnappings of Americans, including U.S. Ambassador Douglas MacArthur.

MEK joined forces with Ayatollah Khomeini until Khomeini took power. MEK then became the revolution’s terror and killing squad. They spied on and betrayed 186 Iranian Air Force officers, the finest pilots who were planning to take back their country. MEK was the firing squad that killed them all.

Iranians have never forgiven MEK for this betrayal.

MEK attacked and took over the U.S. embassy, taking the hostages. Rajavi insisted on killing the hostages, but Khomeini disagreed with him.

When Khomeini refused to give the position of prime minister to Rajavi, he revolted against the regime and unleashed his assassination squads, exploding leading clerics by children strapped with bombs. Iranians will never forgive MEK and Rajavi for the murder of their children.

After Rajavi fled Iran and was deported from Europe, he went to Iraq and joined forces with Saddam Hussein’s military against Iranian soldiers in exchange for money, a camp, and security. Mr. and Mrs. Rajavi made an unknown amount of money from bank robberies in Iran, millions of dollars from Saddam Hussein, and have raised millions of dollars by having their cult members beg for money in international airports around the world for many years while living in communal housing.

In American culture there are groups who live in communal settings and camps, outside society. They follow a charismatic leader and his dictatorial rules and live for a communal goal set by the leader. They are devoid of individuality or a will of their own. These groups are typically called “cults.” Iranians call MEK “the black Marxist cult,” black being the color of Islam.

MEK has never joined the Iranian diaspora or the opposition groups inside the country. MEK has chosen seclusion, and is not part of Iranian society. Mr. and Mrs. Rajavi have appointed themselves presidents of Iran, voted in by their cult members.

The people of Iran don’t need another batch of Islamist dictators who are even more dangerous than the existing Khomeinism. Iranian Americans oppose another self-appointed Islamist jihadist being incorporated into efforts to overturn the current mullah-led government in Tehran.

The Rajavis know that they have no place among the Iranian people, that they are not welcome. Therefore, they are trying to get themselves installed in Iran by foreign powers. In 1978, Ayatollah Khomeini lied to the people of Iran and the world. Many believed him a man of God, peaceful and humanitarian. Let us not make the same mistake by advocating for another anti-American Islamist jihadist.

The Iranian opposition’s proposal for Iran is to end any and all useless dialogues, trade, negotiations, and talks because all of that violates the human rights of the people of Iran. The Iranian opposition’s proposal for Iran is for America to give total support to the grassroots underground freedom movements of women, labor, and youth. Weaken the regime, and let the people of Iran become our free friends and allies.


TOPICS: Editorial; Foreign Affairs; News/Current Events
KEYWORDS: iran; mek; rajavi
"The Rajavis know that they have no place among the Iranian people, that they are not welcome. Therefore, they are trying to get themselves installed in Iran by foreign powers. In 1978, Ayatollah Khomeini lied to the people of Iran and the world. Many believed him a man of God, peaceful and humanitarian. Let us not make the same mistake by advocating for another anti-American Islamist jihadist."
1 posted on 01/27/2011 5:57:45 AM PST by nuconvert
[ Post Reply | Private Reply | View Replies]

MEK flag/emblem
2 posted on 01/27/2011 6:05:21 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies]

BTW- John Bolton has become a supporter of delisting MEK from the State Dept’s Terrorist List


3 posted on 01/27/2011 6:07:20 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith; freedom44; Valin; sionnsar; LibreOuMort; Pan_Yans Wife; Army Air Corps; GOPJ; mazda77; ...

pong


4 posted on 01/27/2011 7:55:49 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

Has anyone CREDIBLE shared the information about MEK with the White House? Certainly the REAL identity and purpose of this organization and its history should be relevant to keeping it listed as a terrorist entity.


5 posted on 01/27/2011 11:44:43 AM PST by LibreOuMort (Give me liberty, or give me death! (Patrick Henry))
[ Post Reply | Private Reply | To 3 | View Replies]

To: LibreOuMort

I’d say Khomeini was smart enough to recognize his own kind, use MeK & the Rajavis to help bring him to power in Iran, but later not share power with them.

A main problem with MeK & the Rajavis, apart from their violent history, is that they are also Stupid.

Ideologically, it will always be much easier for the Mullahs’ regime (regardless of their violent history & atrocious human rights records) to be accepted by (mainstream) Iranians, at least those who are religious, than MeK, because MeK are not simply Islamists, but “Marxist-Islamists”.

As far as I’m aware, initially, many Western countries added MeK to their list of terrorist organizations based on pressure from & demands by IRI (Khomeinist regime). So, it begs the questions: Why list one as a terrorist group, and not the other (IRI)? Is it because IRI is actually in charge of a country & MeK is not?


6 posted on 01/27/2011 4:51:09 PM PST by odds
[ Post Reply | Private Reply | To 5 | View Replies]

To: nuconvert; SunkenCiv; gandalftb
This about the relationship between MEK and KGB is probably not known by those that advocate MEK as a credible source. The following excerpt is from the Archives of the Soviet communist party and Soviet state microfilm collection, 1903-1922: Russian State Archive of Contemporary History (Rossiiskii gosudarstvennyi arkhiv noveishei istorii - RGANI)

Reel 1.993, File 24

Resolution of the TsK KPSS Secretariat approving a response to a letter from M. Rajavi, leader of the Mujahedin [Holy Warriors] Organization of the Iranian People, to M. Gorbachev, and to a request submitted by the organization; two copies of instructions to the Soviet Embassy in Bulgaria to be delivered in ciphered form by the Committee for State Security (KGB); extract from the minutes of the TsK KPSS Secretariat; memorandum to the TsK KPSS from R. Ulianovskii, Deputy Chief of the International Department; letter to Gorbachev from Rajavi (translated into Russian) and the original letter in Persian; statement with information about the collection of documents attached to the letter from Rajavi; memorandum (translated into Russian) to the TsK KPSS from F. Olfat, member of the Politburo of the Mujahedin Organization, and the original letter in Persian requesting that the TsK KPSS lend any amount of money (up to US$300,000,000) to the Mujahedin Organization; memorandum to the TsK KPSS from Olfat, (translated into Russian) and the original letter in Persian requesting that the supporters of the Mujahedin Organization be allowed to cross the Soviet-Iranian border and be granted a temporary asylum in the Soviet Union 1985 December - 1986 February

http://www.oac.cdlib.org/view?docId=kt767nf11z;query=;style=oac4;doc.view=entire_text

7 posted on 07/04/2011 6:58:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
There's a reason MEK have this on their flag ....


8 posted on 07/04/2011 9:14:17 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; ColdOne; Convert from ECUSA; ...

Thanks AdmSmith.


9 posted on 07/04/2011 9:42:56 AM PDT by SunkenCiv (Yes, as a matter of fact, it is that time again -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 7 | View Replies]

To: SunkenCiv

Methyl-Ethyl Ketone? Nasty stuff.


10 posted on 07/04/2011 11:18:23 AM PDT by TheOldLady (FReepmail me to get ON or OFF the ZOT LIGHTNING ping list.)
[ Post Reply | Private Reply | To 9 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson