Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Iranians celebrate LOSING to England in the World Cup - with one fan riding even through Tehran with the Union Flag: Defeat is seen as a slap in the face for hated regime
UK Daily Mail ^ | November 22, 2022 | David Averre

Posted on 11/22/2022 3:00:47 AM PST by C19fan

Iranian football fans are openly cheering the defeat of their national team against England at the World Cup yesterday in yet another sign of protest at the authoritarian Islamic Republic.

Footage emerged overnight of a man sitting on the back of a moped, brandishing a huge Union Jack which streamed behind him as he rode through the streets of Tehran in the wake of his team's 6-2 dismantling in Qatar.

'People are happy because of England's victory,' the man who filmed the spectacle from his car said solemnly.

(Excerpt) Read more at dailymail.co.uk ...


TOPICS: History; Society; Sports
KEYWORDS: iran; iranprotest; worldcup
You are telling me the Mullahs have become so unpopular Persians celebrated England taking Iran to the woodshed? The England which carved up Iran with the Russians/Soviets? The England that Iranians think stole Iranian oil for decades with the Anglo-Persian Oil Company, the predecessor of BP. The England working with the United States overthrew the Mohammad Mosaddegh government in 1953?
1 posted on 11/22/2022 3:00:47 AM PST by C19fan
[ Post Reply | Private Reply | View Replies]

To: All

If Iranians, one of the proudest people on earth, can hate on their national team, then I can hate on Team Rainbow.


2 posted on 11/22/2022 3:02:20 AM PST by C19fan
[ Post Reply | Private Reply | To 1 | View Replies]

To: C19fan

I can relate. I’m rooting against America: first for past kneeling, second for being doodling ambassadors.


3 posted on 11/22/2022 3:08:04 AM PST by Shqipo (Pronouns: Mister/Sir/Lord)
[ Post Reply | Private Reply | To 1 | View Replies]

To: C19fan

“Mullahs have become so unpopular”

The Shah was unpopular, too. I will wait until we see who replaces the Mullahs before I pop the cork on this. But, at least whoever takes over can’t hate us any more than they do now.


4 posted on 11/22/2022 3:50:53 AM PST by beef (Say NO to the WOE (War On Energy))
[ Post Reply | Private Reply | To 1 | View Replies]

To: Shqipo
I’m rooting against America

Me too. I wish one giant bag of nil for the Americans.

5 posted on 11/22/2022 4:52:44 AM PST by JonPreston
[ Post Reply | Private Reply | To 3 | View Replies]

To: C19fan

The team refused to sing along when their national anthem was played before their game


6 posted on 11/22/2022 5:07:15 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: C19fan
The United States doesn't have a national soccer team. They made it clear when they knelt to Communist organizations such as Black Lives MatterTM and wear their rainbow flags that they represent globalists, not the United States.
7 posted on 11/22/2022 5:37:46 AM PST by T.B. Yoits
[ Post Reply | Private Reply | To 2 | View Replies]

To: Shqipo

I do wish in lieu of “America” you’d instead chosen something like “present Admin”.


8 posted on 11/22/2022 6:24:37 AM PST by bobbo666 (Baizuo)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; cardinal4; ...

9 posted on 11/22/2022 10:03:38 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: C19fan

Iranians don’t hate their soccer team. The team publicly dissed the mullahs’ regime as well, just yesterday.


10 posted on 11/22/2022 10:11:39 AM PST by Izzatso
[ Post Reply | Private Reply | To 2 | View Replies]

To: C19fan

There have been many studies over the years showing that about half of Iranians hate the current regime—been that way for decades.

I know how they feel....


11 posted on 11/22/2022 10:15:04 AM PST by cgbg (Claiming that laws and regs that limit “hate speech” stop freedom of speech is “hate speech”.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

Islamic Republic of Iran blames Israel and protesters for its loss at World Cup game
https://freerepublic.com/focus/f-news/4111137/posts


12 posted on 11/22/2022 10:20:46 AM PST by Conservat1
[ Post Reply | Private Reply | To 9 | View Replies]

To: SunkenCiv

Background:
Iranian Regime tv Channel One hacked while it was airing Khamenie speech https://freerepublic.com/focus/chat/4099233/posts?page=138#138


13 posted on 11/22/2022 3:56:58 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson