Free Republic
Browse · Search
General/Chat
Topics · Post Article

Egyptian archeologists comment on carbon dating While the results of Ramsey's research may present a compelling reason to revise records for the two millennia when Egypt dominated the Mediterranean world, Hawass remains categorical in his rejection of the technique: "Not even in five thousand years could carbon dating help archeology. We can use other kinds of methods like geoarcheology, which is very important, or DNA, or laser scanning, but carbon dating is useless. This science will never develop. In archeology, we consider carbon dating results imaginary."

2 posted on 07/16/2010 7:14:09 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv

I wonder if any mention of Moses will be trashed.


5 posted on 07/16/2010 7:43:42 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 2 | View Replies ]

To: SunkenCiv; G8 Diplomat; nuconvert

Hawass is disturbed as he was not involved in the study as he is of the opinion that everything about Egypt has to pass him.

You can read the article here http://web.bgu.ac.il/NR/rdonlyres/55DF630A-CCFA-40CD-A069-7A0304D422C5/99415/DatingPharaonicEgyptBruinsScience2012.pdf

“The New Kingdom, which starts with the reign of Ahmose, began between about 1570 and 1544 B.C.E.”

“Finally, some common sense. Ahmose expelled the Hyksos from Egypt during the timeframe above, more than half a century after Santorini blew in 1628bce. The destruction of Minoan trade networks and the depopulation of Western Anatolia due to toxic volcanic ash allowed Hittite expansion and aggression into that area as well as their long-range sack of Babylon circa 1605bce. In other words, three super-powers bit the dust in 50 years; the Minoans, the Babylonians and the Hyksos. The new Egyptian empire would eventually regain enough strength to take on the Hittites at Qadesh and survive to tell about it.”
http://www.ishtarsgate.com/phpBB3/viewtopic.php?f=28&t=1173&p=10877


10 posted on 07/16/2010 11:40:54 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies ]

To: SunkenCiv

I looked forward to watching the new series on Mummies on the History Channel but was so turned off by the guy you pictured that I doubt that I will watch any more follow up programs. He acted like a total jerk and if it was all an act to make it more interesting, as far as I am concerned, it failed.


16 posted on 07/17/2010 6:42:26 AM PDT by Ditter
[ Post Reply | Private Reply | To 2 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson