Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Egypt: Ramesses II temple unearthed in Upper Egypt
Adnkronos International ^ | Thursday, July 15, 2010 | AKI

Posted on 07/16/2010 7:09:40 PM PDT by SunkenCiv

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041-52 next last

1 posted on 07/16/2010 7:09:45 PM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

Egyptian archeologists comment on carbon dating While the results of Ramsey's research may present a compelling reason to revise records for the two millennia when Egypt dominated the Mediterranean world, Hawass remains categorical in his rejection of the technique: "Not even in five thousand years could carbon dating help archeology. We can use other kinds of methods like geoarcheology, which is very important, or DNA, or laser scanning, but carbon dating is useless. This science will never develop. In archeology, we consider carbon dating results imaginary."

2 posted on 07/16/2010 7:14:09 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 21twelve; 240B; 24Karet; 2ndDivisionVet; 31R1O; 3AngelaD; ..

· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
Gods
Graves
Glyphs
To all -- please ping me to other topics which are appropriate for the GGG list.
GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach
 

·Dogpile · Archaeologica · Mirabilis.ca · LiveScience · Biblical Archaeology Society ·
· Discover · Bronze Age Forum · Science Daily · Science News · Eurekalert · PhysOrg ·
· Nat Geographic · Texas AM Anthro News · Yahoo Anthro & Archaeo · Google ·
· Archaeology · The Archaeology Channel · Excerpt, or Link only? · cgk's list of ping lists ·
· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword · ·


3 posted on 07/16/2010 7:15:04 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

"Et cetera, et cetera, et cetera !"

4 posted on 07/16/2010 7:16:38 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

I wonder if any mention of Moses will be trashed.


5 posted on 07/16/2010 7:43:42 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 2 | View Replies]

To: fieldmarshaldj

One of the more interesting things about Ramses the Great is he had red hair. I have no idea how they determine it but French scientists using an electron microscope were able to read DNA codes. They also say it is not just a guess. They are certain of it.

At first they found henna on his hair and thought he had dyed it red but it turned out he had just kept it it’s natural color as he aged. He clearly was not what we imagine when we think of ancient Egyptians.


6 posted on 07/16/2010 7:45:40 PM PDT by yarddog
[ Post Reply | Private Reply | To 4 | View Replies]

To: yarddog

So he was a Viking ? ;-D


7 posted on 07/16/2010 7:54:50 PM PDT by fieldmarshaldj (~"This is what happens when you find a stranger in the Amber Lamps !"~~)
[ Post Reply | Private Reply | To 6 | View Replies]

To: fieldmarshaldj

He was probably kin to the Scots and Irish. Also a Jewish friend says that King David is traditionally thought to have had red hair. All the Bible says is he had a ruddy complexion which would go along with red hair.


8 posted on 07/16/2010 8:03:51 PM PDT by yarddog
[ Post Reply | Private Reply | To 7 | View Replies]

To: SunkenCiv
Not even in five thousand years could carbon dating help archeology. .... but carbon dating is useless. This science will never develop. In archeology, we consider carbon dating results imaginary.

I have never seen an authority be so blunt about it, but his thoughts parallel with mine on that topic.

9 posted on 07/16/2010 8:25:40 PM PDT by valkyry1
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv; G8 Diplomat; nuconvert

Hawass is disturbed as he was not involved in the study as he is of the opinion that everything about Egypt has to pass him.

You can read the article here http://web.bgu.ac.il/NR/rdonlyres/55DF630A-CCFA-40CD-A069-7A0304D422C5/99415/DatingPharaonicEgyptBruinsScience2012.pdf

“The New Kingdom, which starts with the reign of Ahmose, began between about 1570 and 1544 B.C.E.”

“Finally, some common sense. Ahmose expelled the Hyksos from Egypt during the timeframe above, more than half a century after Santorini blew in 1628bce. The destruction of Minoan trade networks and the depopulation of Western Anatolia due to toxic volcanic ash allowed Hittite expansion and aggression into that area as well as their long-range sack of Babylon circa 1605bce. In other words, three super-powers bit the dust in 50 years; the Minoans, the Babylonians and the Hyksos. The new Egyptian empire would eventually regain enough strength to take on the Hittites at Qadesh and survive to tell about it.”
http://www.ishtarsgate.com/phpBB3/viewtopic.php?f=28&t=1173&p=10877


10 posted on 07/16/2010 11:40:54 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

Thanks AdmSmith for the PDF. D/Led if for later.

However, the conventional pseudochronology is mistaken — the Middle Kingdom didn’t end until about 1450 BC, and the NK didn’t begin until the time of Saul; the last of the Hyksos Pharaohs was killed by the prophet Samuel, who seemed to need some psych meds most of the time. The first Babylonian period ended at the same time as the Middle Kingdom of Egypt, with the invasion of the Kassites.

Egypt was again occupied between the 18th and 19th dynasties, which were not contiguous. Ramses II lost at, and fled from, Kadesh (in this case, Carchemish), centuries after the time he had supposedly lived and died.

Haremhab’s Contemporaries
http://www.varchive.org/tac/hararch.htm

The Allies of Priam
http://www.varchive.org/dag/trowar.htm


11 posted on 07/17/2010 6:23:07 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 10 | View Replies]

To: valkyry1

Among archaeologists, Zahi is all alone in his statement; his statement is based entirely on blind belief and nationalism, with a hint of self-aggrandizement.


12 posted on 07/17/2010 6:34:45 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Quix

Moses lived nearly a thousand years before Ramses II, so there will be no mention to be trashed.


13 posted on 07/17/2010 6:35:59 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 5 | View Replies]

To: fieldmarshaldj

The “making of” extra on the DVD version I have is entertaining, on some days moreso than the movie. :’) YB was half-Mongolian, and he joked about being cast as a pharaoh.


14 posted on 07/17/2010 6:37:55 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

Pharaoh Obama II

15 posted on 07/17/2010 6:41:20 AM PDT by Fresh Wind (For the first time in half a century, there is no former KKK member in the US Senate.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

I looked forward to watching the new series on Mummies on the History Channel but was so turned off by the guy you pictured that I doubt that I will watch any more follow up programs. He acted like a total jerk and if it was all an act to make it more interesting, as far as I am concerned, it failed.


16 posted on 07/17/2010 6:42:26 AM PDT by Ditter
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv
I dont see anything wrong with his statement, maybe you do. He seems to be more of an authority than anyone here or on other chat boards, so you have your opinion.

"Zahi Hawass, Egyptian archeologist and secretary-general of the Egyptian Supreme Council for Antiquities, strongly disagrees with the use of carbon dating in archeology."

“Carbon-14 dating has a margin of error of 100 years. In order to date Egyptian dynasties, we need to have specific dates; you cannot use carbon dating,” Hawass explained to Al-Masry Al-Youm. “This technique shouldn’t be used at all in making changes to the chronology of the ancient Egypt, not even as a helpful addition.”

17 posted on 07/17/2010 7:00:15 AM PDT by valkyry1
[ Post Reply | Private Reply | To 12 | View Replies]

To: Ditter

He’s got a really underdeveloped grasp of what incredulity is, and an overdeveloped sense of grandeur. :’) The old Nat Geog stuff on Egypt is much better anyway, but the DVDs generally have a second, newer program on them, featuring guess who. :’)


18 posted on 07/17/2010 7:05:30 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 16 | View Replies]

To: valkyry1

You have your opinion about Hawass’ authority; meanwhile, the article linked there merely ends with Zowie’s kooky talk, while a real (as opposed to bureaucratic) Egyptologist welcomes the study. But go ahead and saddle on Zahi Hawass’ ignorant statement because it seems to fit into some preconceived and baseless notion.


19 posted on 07/17/2010 7:13:01 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 17 | View Replies]

To: SunkenCiv

Did you watch the other night and do you know what I mean about how he treated people? I have seen him before and he didn’t act like that. Total jerk!


20 posted on 07/17/2010 7:17:01 AM PDT by Ditter
[ Post Reply | Private Reply | To 18 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-52 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson