Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,361-6,3806,381-6,4006,401-6,420 ... 6,521-6,523 next last
To: AdmSmith
Troop losses in the last seven days amounted to 9,7300 !


6,381 posted on 05/16/2024 1:41:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6379 | View Replies]


6,382 posted on 05/16/2024 2:06:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6378 | View Replies]

Russian Offensive Campaign Assessment, May 16, 2024

Russian President Vladimir Putin likely views Russia's relationship with the People's Republic of China (PRC) as decisive to his effort to further mobilize the Russian economy and defense industry to support a protracted war in Ukraine. Putin arrived in Beijing and met with PRC President Xi Jinping on May 16, and the two leaders signed a series of documents intended to recognize and deepen their bilateral cooperation.[14] Putin and Xi signed a joint statement, several agricultural and ecological agreements, an infrastructure and engineering construction agreement, and several media agreements.[15] Putin and Xi highlighted bilateral trade and economic cooperation throughout their public speeches, and Putin's delegation included several Russian officials and businessmen likely involved in Putin's efforts to further mobilize the Russian defense industry, including Russian Defense Minister Andrei Belousov, Security Council Secretary Sergei Shoigu, Federal Service for Military-Technical Cooperation Head Dmitry Shugaev, Russian aluminum company RUSAL founder Oleg Deripaska, Rosneft CEO Igor Sechin, and Russian Direct Investment Fund CEO Kirill Dmitriev.[16]

Belousov professed his intention to focus on integrating the Russian military's economy into the general Russian military economy during a speech on May 14, and Putin announced that Shoigu will work with the Presidential Administration's Military-Industrial Complex Commission on May 15.[17] The Russian delegation likely aimed to expand cooperation with their Chinese counterparts that will facilitate increased economic ties between Russia and the PRC. The Economist reported on April 29 that Russia's defense industry has increasingly relied on the PRC to provide dual-use goods, such as semiconductors and navigational equipment, to support arms production.[18] US Secretary of State Antony Blinken stated on May 1 that PRC exports of dual-use goods to Russia have helped Russia significantly increase its defense production and that 70 percent of Russia's machine tools and 90 percent of its microelectronics are from the PRC.[19] The PRC has previously signaled concerns that its economic relationship with Russia may place PRC entities under threat of secondary sanctions, and Putin likely intends to head off these concerns as the Russian defense industry grows increasingly reliant on the PRC.[20]

Putin also used his meeting with Xi to promote known Kremlin narratives feigning interest in peace negotiations and a diplomatic resolution to Russia's invasion of Ukraine. Putin and Xi signed a joint statement on May 16 that alluded to Russia's support for the PRC's proposed peace plan and a possible future PRC-led negotiation to end the war in Ukraine.[21] The statement claims that both Russia and the PRC are against any efforts that prolong or further escalate the war and that both countries support a “sustainable settlement” for the “Ukraine crisis.” Xi stated during a joint press conference with Putin that the PRC and Russia both perceive a political settlement as the right way to resolve the situation in Ukraine.[22] ISW has previously assessed that the Kremlin will continue to use any calls for peace negotiations to feign interest in negotiations in hopes of undermining Western support for Ukraine and prompting the West to force Ukraine into negotiations with Russia that make concessions on Ukrainian sovereignty and territorial integrity.[23]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-16-2024

6,383 posted on 05/17/2024 3:36:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6380 | View Replies]

To: adorno; alexander_busek; AmericanInTokyo; Apparatchik; ArtDodger; AZJeep; baclava; BeauBo; ...
Russian blogger:

The ashes of the great commander Suvorov were divided into two parts.

This was done on the instructions of Sergei Shoigu, sources close to the Secretary of the Security Council told us. “Part of the ashes of the great commander, who you see, helps us advance at the front, truly leads our soldiers forward, now in the Kharkov region. It's not easy there. Some of them, on the initiative of Sergei Kuzhugetovich [Shoigu], began to be transported to defense industry enterprises. Chemezov personally gave the go-ahead,” one of our interlocutors told us.

According to another, Shoigu planned to take particles of Suvorov’s ashes to China, but he was not allowed. They said that “there is no point in shocking our Chinese friends with bones and exposing Vladimir Vladimirovich.”

Sergei Kuzhugetovich was forced to obey. But he believes that particles of the remains of the great commander could help achieve more during the visit. For example, direct supplies of Chinese weapons to us.

https://t.me/kremlin_secrets/4108

What do we know about Magical thinking in Russia?

Chertishchev MS. Magical thinking in normal and pathological conditions: literature review.Neurology Bulletin.2022;LIV(4):32–44.

“The spread of irrationality and magical thinking inperiods of crisis in society is also mentioned by otherauthors. It has been established that people living in combat areas and experiencing severe stress are more prone to magical thinking and superstition. Several studies reveal the relationship between magical thinking and various forms of psychological defense.”

“In the Russian-speaking sample, a comparison of the magical thinking levels in groups of patients with various mental disorders and healthy subjects did not show any differences between them,”

https://journals.eco-vector.com/1027-4898/article/view/108946/pdf_1

6,384 posted on 05/17/2024 4:18:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6363 | View Replies]

“Black Colonel” V. Alksnis:

My brief analysis of China’s position on the Ukrainian crisis, as set out by Chinese President Xi Jinping in a press statement following the Russian-Chinese negotiations in Beijing on May 16, 2024
http://www.kremlin.ru/events/president/news/74045

“China’s position on this issue [the Ukrainian crisis] is consistent and clear, namely: compliance with the norms and principles of the UN Charter, respect for state sovereignty and TERRITORIAL INTEGRITY of all countries and their rational concerns about the security of the formation of a new balanced, effective and sustainable security architecture”

1. Compliance with norms and principles of the UN Charter – pro-Ukrainian position.
From the point of view of Ukraine and its allies, the SVO is Russia’s aggression against Ukraine and a gross violation of the norms and principles of the UN Charter. Unfortunately, this position is supported by the majority of UN member countries;
2. Respect for state sovereignty and territorial integrity of all countries is a pro-Ukrainian position.
Ukraine and its allies consider Russia an aggressor country that has violated the sovereignty and territorial integrity of Ukraine. And to eliminate the consequences of these actions of the Russian Federation, they require the withdrawal of Russian troops from the territory of Ukraine, the return of Crimea, Donbass, Zaporozhye and Kherson regions under the control of Ukraine and a return to the 1991 borders;
3. Rational security concerns - a pro-Russian position in connection with NATO’s expansion to the East and Russia’s demands to stop it;
4. Formation of a new balanced, effective security architecture – the position is partially pro-Russian. But frankly speaking, this position of China means nothing. It is impossible to create an effective security architecture in the coming years, or even decades.

Well, who thinks that China is an ally of Russia? Forget it!

China is following its own path and will support Russia only when it benefits it.

https://t.me/blackcolonel2020/1381


6,385 posted on 05/17/2024 5:14:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6384 | View Replies]


6,386 posted on 05/17/2024 5:23:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6382 | View Replies]


6,387 posted on 05/17/2024 5:26:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6381 | View Replies]

At least 4 112 Russian officers have been eliminated in Ukraine. Minimum losses since 24 February ’22. Each name is confirmed by a Russian source via funeral notices, obituaries, graves, news platforms, monuments and memorial plaques.

https://x.com/KilledInUkraine/status/1791416952545489091

6,388 posted on 05/17/2024 5:37:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6387 | View Replies]

To: AdmSmith

Good stuff. Come to think of it, Soviet communism was a long episode of magical thinking on a grand scale.


6,389 posted on 05/17/2024 6:22:45 AM PDT by Rockingham (`)
[ Post Reply | Private Reply | To 6384 | View Replies]

To: AdmSmith

“What do we know about Magical thinking in Russia?”

Lysenkoism was a perfect example of magical thinking in Russia.

In a way, the persecution of Russians who criticize the leadership in Russia is also an example of magical thinking. Because if no one is allowed to say anything bad then everything is fine, see?


6,390 posted on 05/17/2024 8:17:04 AM PDT by MeganC (Ruzzians aren't people. )
[ Post Reply | Private Reply | To 6384 | View Replies]

To: AdmSmith

Thanks for the ping AdmSmith


6,391 posted on 05/17/2024 8:35:58 AM PDT by GOPJ ( MSNBC ghouls pretend their 'base' is elites - it's why Biden won't campaign in the black community.)
[ Post Reply | Private Reply | To 6384 | View Replies]

To: GOPJ; Rockingham; MeganC
This Wagner officer who handles recruitment etc in Africa is not happy with the Russian Ministry of Defense, and it can safely be assumed that in the below he speaks for the majority of officers.:

The Western private company Maxar Technologies, which has more than 80 of its satellites in orbit, as expected, recorded the consequences of a Ukrainian missile attack on the Russian Belbek airfield, which was carried out by the enemy on the night of May 15.

Most of the z-bloggers who orgasm from the quote “you can make mistakes, you can't lie,” stated that they repelled the attack with our air defense forces. But, alas, now, based on the results, it can be stated that at least 3 of the supposed 10 MGM-140 ATACMS missiles reached the target set by the enemy.

As a result of the hit, two MiG-31 high-altitude fighter-interceptors (carrier of the Kinzhal hypersonic missile), one Su-27 fighter were destroyed, and the MiG-29 fighter was also heavily damaged.

In addition to the aviation component, losses were also suffered in the air defense division itself. For example, two S-400 air defense missile launchers and a 92N6E radar were allegedly destroyed.

Unfortunately, there are dead and wounded among the personnel of the Russian Armed Forces.

Now again and again the question of equipping strategically important airfields with reinforced concrete shelters for aircraft is being raised. That was not done either earlier, or even after two years of war and the destruction of a dozen aircraft.

As we remember, the only thing the Russian Ministry of Defense did was cover the fuselage of the planes with tires and paint the silhouettes of the planes at their parking areas, which, according to stripes, were supposed to deceive Western satellite reconnaissance.

But, apparently, building 1,500-square-meter mansions for Russian Deputy Defense Ministers is much easier and more expedient than shelters for multibillion-dollar aircraft.

https://t.me/grey_zone/23063

6,392 posted on 05/17/2024 9:29:18 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6391 | View Replies]

To: AdmSmith
But, apparently, building 1,500-square-meter mansions for Russian Deputy Defense Ministers is much easier and more expedient than shelters for multibillion-dollar aircraft.

Short sighted...

6,393 posted on 05/17/2024 9:08:22 PM PDT by GOPJ ( MSNBC ghouls pretend their 'base' is elites - it's why Biden won't campaign in the black community.)
[ Post Reply | Private Reply | To 6392 | View Replies]

Russian Offensive Campaign Assessment, May 17, 2024

Russian President Vladimir Putin attended the annual Russian-Chinese Expo and forum on interregional cooperation and visited Harbin Polytechnic University during the second and last day of his trip to the People's Republic of China (PRC) on May 17. Putin focused his remarks at both events on increased Russian-Chinese economic cooperation and cultural exchange.[76] Putin also met with PRC Vice Chairman Han Zheng.[77] ISW continues to assess that Putin likely views Russia's relationship with the PRC as decisive in his effort to further mobilize the Russian economy and defense industry to support a protracted war in Ukraine.[78] US State Department Spokesperson Dev Patel stated on May 16 that the US believes that the PRC's “reconstruction” of Russia's defense industry is deeply problematic and that the US continues to monitor the situation.[79]

Putin continued to use his visit to China on May 17 to promote longstanding boilerplate information operations about Russia's feigned interest in negotiations.[90] Putin repeatedly referenced a Russian information operation alleging that Western officials previously coerced Ukraine to reject an agreement favorable to Russia during a press conference with People's Republic of China (PRC) President Xi Jinping.[91] Putin claimed that the PRC is sincerely trying to solve the war in Ukraine, attempting to depict the PRC as a neutral mediator in the hopes that Chinese involvement in envisioned negotiation processes may lead to negotiations that are more favorable to Russia.[92] The Kremlin will continue to feign interest in negotiations in hopes of undermining Western support for Ukraine and prompting the West to offer concessions on Ukrainian sovereignty and territorial integrity.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-17-2024

6,394 posted on 05/18/2024 2:14:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6383 | View Replies]


6,395 posted on 05/18/2024 2:15:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6386 | View Replies]

To: AdmSmith
500,000 by June 1?


6,396 posted on 05/18/2024 2:18:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6387 | View Replies]

To: AdmSmith; PIF; MeganC; USA-FRANCE; blitz128; BroJoeK; Timber Rattler; Widget Jr; Monterrosa-24; ...

500,000 by JUne 1? I would take that bet. Thank you for keeping us informed.


6,397 posted on 05/18/2024 10:02:43 AM PDT by gleeaikin ( Question authority.)
[ Post Reply | Private Reply | To 6396 | View Replies]

To: AdmSmith
Russian blogger:

People of the new Minister of Defense offered us money!

After we talked about Andrei Belousov’s visit to the Diveyevo Monastery and what happened there after that, they tried to get in touch with us. A person close to the new Minister of Defense offered us cooperation. And we think it's worth telling our readers about this for two reasons.

Firstly , from a media point of view, Belousov understands that the position of the Minister of Defense of a warring country will always be the focus of attention, and a lot of criticism awaits him. From this point of view, establishing contact with key media platforms is a good initiative. Obviously, it will be possible to come to an agreement with someone.

Secondly, we were offered quite good money. Our silence was valued at one million rubles a month. In principle, quite generous. But we refused. This, if you remember, is not the first attempt to bribe the Kremlin snuffbox, but we don't want to spoil our aura. [see below] The truth is important, because sometimes it can even save lives, including our military.

We will certainly monitor Belousov’s activities as Minister of Defense. It will be interesting to see how a man without a large team will reform such a huge system in a war.

https://t.me/kremlin_secrets/4115

19NOV2023 Abramovich's people want to buy “Табакерку” [=snuff box = this channel]. Here's what we think about it

This is not the first time we have received an offer to sell the Kremlin Табакерку channel. A year ago they offered a million rubles for the channel, now the price has increased 10 times.

We were offered 10 million for the channel and another million on top for urgency. One of the channel's admins was contacted by an intermediary who had previously worked with Roman Abramovich. He hinted that our publications about his possible participation in the elections somewhat interfere with the plans of the businessman.

Let us answer publicly at once to all those wishing to buy this channel - “Табакерку” is not for sale. The channel was created by independent journalists who are really well connected, but may not always agree with the actions of the authorities. Yes, we are against war. We do not like the meat grinder in which tens of thousands of our citizens have died. At the same time, we realize that hiding the truth is also a crime. And we do not intend to be complicit in it. And yes, we support our military, although we do not always agree with the decisions of individual generals.

We will speak the truth and tell what, alas, will not be shown on federal television. We are not after the long ruble and have not placed a single advertisement in the channel for the whole time. “Табакерку” is about the future. In which the truth cannot be bought. And we value our readers too much to cheat them.

On the eve of the elections, we are ready to publish interviews with all the candidates, including Vladimir Putin and Roman Abramovich. The questions will not be easy, but we are giving all participants in the election a chance to speak out.

https://t.me/kremlin_secrets/3150

10 Million Ruble is about $110,000. The average accrued salary in Russia is 70.9 thousand rubles in September 2023 - an increase of 14.6% y/y and 29.7% over two years.
https://tadviser.com/index.php/Article:Average_salary_in_Russia#Average_accrued_salary_70.9_thousand_rubles

6,398 posted on 05/18/2024 2:59:54 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6376 | View Replies]

Russian Offensive Campaign Assessment, May 18, 2024

Russian Security Council Deputy Chairperson Dmitry Medvedev called for Russia’s envisioned “buffer zone” to encompass all of Ukraine, illustrating that the Kremlin’s concept of the buffer zone is a thinly veiled justification for Russia’s long-held intent to subsume the entirety of Ukraine and likely an effort to garner domestic support for the Russian war effort. Medvedev stated in a post on his Russian-language Telegram channel on May 17 that Russia’s “sanitary [buffer] zone” must at least extend over all central Ukraine and a significant part of western Ukraine in order to place Russian cities out of the range of Ukraine’s Western-provided long-range strike systems.[39] Medvedev claimed that if Ukraine continues to strike Russian cities, then Russian forces will have to extend the sanitary zone further to Ukraine’s western border with Poland or within Poland itself. Mikhail Zvinchuk, founder of the Rybar Telegram channel, also called during an interview on May 18 for Russian forces to occupy additional areas of Ukraine as part of a “buffer zone,” claiming that Russian forces should seize areas of Sumy and Chernihiv oblasts along the Russian border.[40]

Russian President Vladimir Putin recently characterized Russia’s offensive operations in northern Kharkiv Oblast as part of Russia’s effort to develop a “buffer zone” on Ukrainian territory to defend Belgorod City against Ukrainian strikes.[41] Russian Foreign Minister Sergei Lavrov suggested during an interview on April 19 that Russian forces will have to keep attacking further into Ukraine to protect the settlements that come under Russia’s expanding buffer zone, insinuating that the Kremlin intends to use the creation of a buffer zone to justify Russian offensive operations even further into Ukraine.[42] Medvedev’s and Zvinchuk’s comments highlight Russia’s likely intent to use this buffer zone narrative to justify Russia’s occupation of all of Ukraine. Medvedev’s decision to publish this post on his Russian-language Telegram channel suggests that his message is intended for a domestic Russian audience, and Medvedev may intend to generate support and excitement around an imagined future Russian victory in Ukraine ahead of Russia’s anticipated summer 2024 offensive operations, which will likely result in large-scale Russian personnel losses.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-18-2024


6,399 posted on 05/19/2024 1:15:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6394 | View Replies]

To: gleeaikin
Dugin again

In Russia they want to ban divorces.

Philosopher Alexander Dugin came up with this idea. He is preparing its rationale and plans to convey his proposals to Vladimir Putin in the coming weeks. “Alexander Gelyevich understands that his idea may be rejected, because Vladimir Vladimirovich himself was divorcing his wife. Therefore he has two options. More radical is a complete ban on all divorces. The second option is to allow divorce only once (it is assumed that in this case you will have to pay a fine of 50 thousand rubles). And the second, third and other divorces should be prohibited. Alexander Gelevich also believes that it is imperative to prohibit those who were married in church from getting divorced,” a source close to Dugin told us.

He believes that the second option “will suit everyone and will work to strengthen the institution of the family.” The interlocutor also claims that the idea of ​​​​banning divorces is supported by Ekaterina Mizulina.

At the same time, evil tongues say: Dugin is preparing the ground for a reaction to the possible publication of compromising evidence against him. Let us remind you that the leader of the “Metal Corrosion” group, Sergei (“Spider”) Troitsky, threatens to publish a video in which Alexander Gelyevich takes drugs, engages in pedophilia and, according to our sources, “zigs” naked. We wrote more about this situation and this compromising evidence here [ https://freerepublic.com/focus/news/4042550/posts?page=6302#6302 ]

https://t.me/kremlin_secrets/4118

6,400 posted on 05/19/2024 8:36:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6302 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,361-6,3806,381-6,4006,401-6,420 ... 6,521-6,523 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson