Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

DNA sleuths read the coronavirus genome, tracing its origins and looking for dangerous mutations
Stat ^ | JANUARY 24, 2020 | SHARON BEGLEY

Posted on 01/24/2020 10:29:27 PM PST by aquila48

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120121-127 last
To: SunkenCiv; SeekAndFind; nuconvert; gandalftb
Below is a possible scenario for the Covid-19 pandemic, assuming that it is widespread.

First see these four simulations https://www.washingtonpost.com/graphics/2020/world/corona-simulator/ ; no restrictions, forced quarantine, moderate and extensive distancing. It shows the distribution of healthy, sick and recovered persons under the assumption that recovered persons are immune.

Now, add R0, the average number of new infections caused by each case in an entirely susceptible population.

For Covid-19 it is something between 2.5 and 3.3. This means that there will be herd immunity at between 60 - 70 % of the population (1-1/R0) Herd immunity is a form of indirect protection from infectious disease that occurs when a large percentage of a population has become immune to an infection, thereby providing a measure of protection for individuals who are not immune.
https://en.wikipedia.org/wiki/Herd_immunity

As there is no vaccine and no vaccine will be ready soon, immunity will be produced by sick persons that are recovered.

Present information indicates that about 80 % of the infected will have a mild disease. In order to protect the elderly a solution would be to prevent those elderly from being infected, and, sad to say, encourage the spread of infection among the younger. This would reduce the mortality rate for covid-19.

The above text as well describes why the conclusion in the below article is wrong: https://medium.com/@joschabach/flattening-the-curve-is-a-deadly-delusion-eea324fe9727

121 posted on 03/15/2020 9:36:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 120 | View Replies]

To: AdmSmith

TWiV 591: Coronavirus update with Ralph Baric. Ralph Baric joins TWiV to dissect the coronavirus pandemic caused by SARS-CoV-2, including discussion on community spread, asymptomatic infections, origin of the virus, transmission, vaccine development, and much more. http://www.microbe.tv/twiv/twiv-591/

A summary https://medium.com/@hpcngmoh/you-will-be-hard-pressed-to-find-higher-quality-virological-information-during-this-outbreak-as-a1c7b53d686a


122 posted on 03/15/2020 9:39:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 121 | View Replies]

To: AdmSmith

Good news. Rhesus macaques seem to be immune to re-challenge with SARS-CoV-2. This suggests that we are also immune once we clear the infection (serology in humans points in same direction). Not sure how long immunity lasts but likely for months or years.

https://twitter.com/florian_krammer/status/1239036927535448069


123 posted on 03/15/2020 9:44:11 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 122 | View Replies]

To: AdmSmith

Percolation Models

https://es.coursera.org/lecture/model-thinking/about-GiJJw


124 posted on 03/15/2020 9:47:09 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 123 | View Replies]

To: AdmSmith

I live near McCord/FT. Lewis bases. The off base food vendors are voluntarily closing inhouse dining, drive-through only.
.........
Word has it (?) that those food vendors without drive-through will be placed off limits if there are any infections reported.
...........
Essential only travel off base is be asked for now, they may close the base.


125 posted on 03/15/2020 9:53:05 AM PDT by gandalftb
[ Post Reply | Private Reply | To 120 | View Replies]

To: gandalftb
In May those that have had covid-19 will have a strong and useful CV.
126 posted on 03/15/2020 11:39:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 125 | View Replies]

To: AdmSmith
Thanks AdmSmith.

127 posted on 03/15/2020 12:10:04 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 121 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120121-127 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson