Posted on 11/01/2007 5:53:26 PM PDT by truthfinder9
[[Actually I’m begging someone to show the magic flaw in descent with modification. Bring it on. Imagine the look on the faces of the tens or thousands of PhD biologists, chemists, physicists, astronomers, geologists, when you show up with your strenuous look]]
I doubt they’ll even bat an eye- after all, something like biological impossibilities certainly doesn’t phase their beleifs
[[I can fully understand. It must be hell keeping track of the creationists who’ve turned to the dark side — Michael Denton, Yockey, and now Michael Behe.]]
Three? That’s it? But I’ll tell you, it’s not nearly as strenuous keeping track of three who ignore biological impossibilities as it is keeping track of hte myriad of former evolutionists who turned to the light and are now ID’ists. Besides, I’m not sure Behe was ever a creationist If he was, he was a creationist/ slash macroevolutionist who always thought God started the process- technically, these folks haven’t ‘turned’, they’ve just become more mired in error :)
B_Sharp to valkyry1 : [[Have you analyzed the assumptions your belief system is based on?]]
Just one- but it’s an assumption that is strengthened by God’s Holy spirit’s Testimony in our lives as well as strengthened by eyewitness accounts of God and Christ’s creative omnipotence, and strengthened by scientific evidence of intelligence and design
valkyry1 to coyote [[For your information, you come across more as a crusader than a scientist]]
Yup, bingo— the very thing he rails against and falsely accuses of, he himself engages in heavily
[[Have you brought your assurance that molecules cannot replicate to the attention of Dr. Julius Rebek, Jr, Dr M Reza Ghadiri, Dr. Guntr KieDrwski, or other of the many scientists who have developed self-replicating molecules or are actively researching in the area? If not, here is your chance]]
Technically, they are ‘self’ replicating- they rely on forces to replicate- forces that their DESIGN are capable of utilizing. Replications are duplicates of their selves, but no, they aren’t ‘self’ replicating. “Self’ replicating implies that they are capable of producing hte energy themselves to replicate themselves. A point must be made here that the energy needed for true macroevolution would be so destructive that it would annihilate any organisms right from the start- The experiments to ‘create’ molecules from chemicals failed miserably in that they had to so isolate the cells from the energy needed to create them in the first place, that it was an unrealistic model of dynamic real world experiences. As well, they had to isolate the wrong left handed amino acids from hte right hand ones because the combining of the two destroyed the ones needed to create viable amino acids capable of existing in highly controlled lab environments. Just a little diddy that not many people are aware of when discussing the ‘amino acids from chemical’ experiments that were carried out for decades.
I’m still waiting for you or someone to show us the magic flaw in descent with modification. Bring it on. Imagine the look on the faces of the tens or thousands of PhD biologists, chemists, physicists, astronomers, geologists, when you show up with your strenuous look
Interesting. Cells produce their own energy?
Yes. If you would bother reading the work done by scientists who work in the fields referenced by Dembski and Behe, including mathematicians and biologists who understand the theory and the practical consequences of Dembski and Behe's work as well as Dembski and Behe do, you would not be asking that question. Dembski's CSI and Behe's IC have been debunked multiple times. Each time Dembski comes up with some putative correction to his hypotheses, numerous mathematicians point out the flaws in the assumptions and numerous biologists point out the flaws in his understanding of biolgy. Every time Behe comes up with a supposed Irreducibly Complex system (which is really inapplicable the way it is normally defined) a number of scientists show that the system can evolve.
Behe's Irreducible Complexity is irrelevant because it deals exclusively with how to break something not how to not build something. Many systems can be assembled piece by piece, using scaffolding and co-option of function, that will break if a subsystem is removed. To make an analogy, IC claims that if you can remove a single block from a structure built of a child's building block set and have the entire structure collapse, the structure could not possibly have been built. That isn't the same as showing that a specific building block could not be positioned in a specific place with a range of functions. If you want evidence of the ability of biological systems to change function look up the precursor to hemoglobin.
"As well, the mathematical improbabilities calculated by the Wistar scientists make the idea of Macroevolution an impossiblity-"
In my last post I took three of those calculations, or rather the results of those calculations, the calculations themselves were not shown on the page I read, and I showed why those calculations were invalid. If you want me to debunk one of their calculations then give me a single instance, don't expect me to go through their entire set of publications and debunk each and every one. It is very easy for you to sit there and point me to a pile of documents but so much more difficult for me to slog through them all. You go through as many as you want, pick one, present it here and I'll do what I can to address it.
"Irrelevent assumptions? please do explain. The fact is that these calculations are not just based on the necessity of one or several or even a few hundred positive mutations being produced, it’s based on the fact that the myriad of system changes that number in the trillions would neeed just as many positive and ever increasingly complex mutations in order for Macro to be aeven a slgiht possibility."
The calculation I addressed was very specific. It calculated the probability of two specific genes placed in a specific order in E.coli. The assumption is that the two E.coli genes would have to occur in the order they are in, in the exact form they currently have, randomly and spontaneously. That type of calculation assumes that the presence of each nucleotide is independent of every other and is usually nothing more than the number of bases (4) to the power of the number of positions (x). If we assume, for argument's sake, that x=100 then the probability of an ordered string with an alphabet of 4 of length 100 would be .622x10-61.
However if we lose the requirement for the two genes to be in some specific sequence*, lose the requirement that the two genes appear suddenly rather than be a modification of pre-existing sequences*, add in the enormous number of different types of genetic modification*, add in affects of selection* and fixation* and the entire calculation becomes a waste of time and completely useless. The calculation simply does not reflect reality.
*As has been observed.
"The fact is that in al lthe years of study, practically every mutation seen has been either deleterious or neutral with only a VERY few having a benign unintended immediate positive effect, but the mutations htemselves are still deleteriosu and add to increased deaths"
You have, in your body ~100 mutations your parents do not have. There are 6 billion people in the world (and this doesn't include all those with immediately deleterious mutations resulting in death), far more than has ever lived before. Even if we assume that all of those mutations are single nucleotide changes that do not result in a changed reading frame, that means there is potentially 600 billion mutations in the population. Assuming that mutations at all positions in the genome have equal probability and that 1/3 of them will occur on the third base in a codon (which doesn't change the amino acid) that leaves 200 billion mutations. Our genome is 3 billion long, with only 2 billion affecting the amino acid.
How many of the population of 6 billion will live beyond 70? How many will die of deleterious mutations?
With the capacity for every possible single nucleotide mutation in our genome to occur, where are the enormous numbers of deaths from deleterious mutations?
I notice that you still have the requirement that all mutations be immediately deleterious or beneficial. Why is that? Whether a mutation which does not immediately kill the organism, especially those which affect morphology, is deleterious of beneficial is determined by the environment. If the environment changes, then the status of applicable mutations change.
You seem to be stuck in the idea that the only way macro evolution could happen is through some radical saltation event. Something like a theropod suddenly developing wings, modified ribs, and a more efficient cardio-vascular system all in one generation. Is that what you believe?
"[[No genes were produced by random chance. No evolutionary biologist claims they were. This by itself debunks this ‘proof’.]
That doesn’t disprove their calculations at all- of course the genes had to be produced by random chance- A mutation is a random mistake regardless of the selective pressures."
Actually those calculations assume that the entire gene appears at once.
GATCTGTCTATAGTCTATGTGTAACA
The probability of the above string forming all at once is .222x10-16. This is the type of calculation you and your sources use.
Assuming only SN changes, what should be calculated is the probability of changing an existing gene into a new gene.
Original gene:
GAACTGTCTATAGACTATGTGAAACA
target gene:
GATCTGTCTATAGTCTATGTGTAACA
The probability of changing the original to the target is .111
Big difference.
Now the kicker - neither calculation tells us a damn thing about biology, they simply don't reflect reality.
"“Self’ replicating implies that they are capable of producing hte energy themselves to replicate themselves.'
No it doesn't. It means that the natural processes of chemistry use available energy and raw materials to grow molecules.
"A point must be made here that the energy needed for true macroevolution would be so destructive that it would annihilate any organisms right from the start"
What the heck do you think macro evolution is?
I would like you to examine a black bear and a raccoon and list all the differences between them, then tell me how much energy it would take to change a raccoon into a bear using small changes over, let's say, 200,000 generations.
How about doing the same for a hippo and a whale.
"As well, they had to isolate the wrong left handed amino acids from hte right hand ones because the combining of the two destroyed the ones needed to create viable amino acids capable of existing in highly controlled lab environments. Just a little diddy that not many people are aware of when discussing the ‘amino acids from chemical’ experiments that were carried out for decades."
Where do you get this nonsense?
Please give me the link to your source for this.
Amino acids have been found in space, on meteorites and have been produced through simple lab experiments, including simulations of space where ice is bathed in ultraviolet light, and in 'concussion' experiments. Amino acids form in all kinds of natural situations.
Your diddy is wrong.
Dr. Rebek’s findings were made in 1990
I googled these guys. And what I found was that many a paper has been written on these topics by these men, and those papers have been cited by others.
However some scientists agree with them, and others do not. And also this compound made by Dr. Julius Rebek Jr., a chemist at the Massachusetts Institute of Technology, and his team, they hypothesize that it self replicates. And then this quote by
Dr Ghadiri: None of the molecules that have been made would sustain themselves (be able to continue self-replication) in an environment outside of the chemical reactions under which they are able to self-replicate, says Dr Ghadiri. These molecules, he says, are themselves chemical reactions. They just happen to be self-replicating molecules that mimic one of the processes -- self-replication -- that is found in what we call living organisms.
Other answers for what happens in that process may later be found, such as a more simpler answer that a reaction is started in a chloroform solution containing the exact amounts of the reactants, which in turn produces amino adenosine triacid ester (AATE) until all the reactants are used up. For instance, there may be an unknown/unmeasurable contaminate which acts as a catalyst to kick the reaction off.
You can’t self-replicate in the absence of oxygen. Even in the presence of oxygen, you will survive only until it is used up.
RW - really - does the date matter?
You made the claim that self replicating molecules are impossible. You said it in more than one post. To refute that claim, all I have to do is present a logical path to such a model which conforms to all known physical laws. I did better than that, I showed you that self replicating molecules are far from impossible and have actually been produced.
You will note that none of those molecules were produced by any means other than through the processes you posted a definition of earlier.
[[No it doesn’t. It means that the natural processes of chemistry use available energy and raw materials to grow molecules.]]
Thank you for validating hte fact that cells aren’t ‘self’ replicating.
[[I would like you to examine a black bear and a raccoon and list all the differences between them, then tell me how much energy it would take to change a raccoon into a bear using small changes over, let’s say, 200,000 generations.]
2 watts
[[How about doing the same for a hippo and a whale.]
3.27 watts
[[Amino acids have been found in space, on meteorites and have been produced through simple lab experiments, including simulations of space where ice is bathed in ultraviolet light, and in ‘concussion’ experiments. Amino acids form in all kinds of natural situations.
Your diddy is wrong.]]
No it isn’t- you can look up the miller experiments yourself, but here’s a primer http://www.answersingenesis.org/tj/v18/i2/abiogenesis.asp
[[Actually those calculations assume that the entire gene appears at once.
GATCTGTCTATAGTCTATGTGTAACA
The probability of the above string forming all at once is .222x10-16. This is the type of calculation you and your sources use.
Assuming only SN changes, what should be calculated is the probability of changing an existing gene into a new gene.
Original gene:
GAACTGTCTATAGACTATGTGAAACA
target gene:
GATCTGTCTATAGTCTATGTGTAACA
The probability of changing the original to the target is .111
Big difference.
Now the kicker - neither calculation tells us a damn thing about biology, they simply don’t reflect reality.]]
You’re describing Microevolution- not Macroevolution- the calculations deal with Macro- not Micro, as well, you shopw nothign about whether that change is a ‘positive’ change or not, you just simply illustrate change- The Wistar calculations dealt with the probabilities of positive mutations advancing a species beyond it’s own kind, not in Microevolution
[[You seem to be stuck in the idea that the only way macro evolution could happen is through some radical saltation event. Something like a theropod suddenly developing wings, modified ribs, and a more efficient cardio-vascular system all in one generation. Is that what you believe?]]
No- Macroevolution is gain of NEW non species specific information, notr simply on alterations of existing informaiton- NEW non species specific information would have to be introduced from a dissimilar species such as in lateral gene transference- You and I have been over htis many a time here on FR
[[Behe’s Irreducible Complexity is irrelevant because it deals exclusively with how to break something not how to not build something.]]
Actually htat’s not true- He shows why it would be impossible to construct fully functioning systems from scratch, and then goes on to show why it would not be able to be built piecemeal but had to be created and assembled all at once- thjis really is the crux of ID- they don’t just show why somethign is irreducible, they also explain that piecemeal conbstruction from random mutations would never succeed in buolding htese irreducibly dcomplex systems.
[[If you want evidence of the ability of biological systems to change function look up the precursor to hemoglobin]]
Noone is talking about changing fucntions- we’re talking about irreducibly complex systems- there’s a difference. Hemoglobin has absolutely nothign to do with irreducibly complex systems such as the eye or hearing or any other number of irreducibly complex systems. While it might be itneresting to contemplate describing events for which there is absolutely no evidence to show for, the ‘rebuttles’ to specified complexity are nothign more than conjecture based on assumptions with no evidence ot support hte ideas whereas ID CAN be tested to show that a removal of a component WILL cause a breakdown.
[[Yes. If you would bother reading the work done by scientists who work in the fields referenced by Dembski and Behe, including mathematicians and biologists who understand the theory and the practical consequences of Dembski and Behe’s work as well as Dembski and Behe do, you would not be asking that question.]]
As you well know- their rebuttles to Demski and Behe have themselves been rebuttled.
[[Dembski’s CSI and Behe’s IC have been debunked multiple times.]]
That’s not true
[[Every time Behe comes up with a supposed Irreducibly Complex system (which is really inapplicable the way it is normally defined) a number of scientists show that the system can evolve.]]
No sir- a number of scienctists come up with putative corrections to their own hypothesis, and tailor them based on assumptions- The matter is far from debinked- As you well know- Science is a constant process of reevaluation, and it is also a science abotu hte past- not about known absolutes- although ID science is about testing and measuring knowns. Behe’s ID has not been debunked- far from it. The scientists come up with ASSUMPTIONS about systems with absolutely NO evidence to back up their assumptions that these irreducibly complex systems could have been built- to suggest htat they have is simply wrong.
js1138 [[Interesting. Cells produce their own energy?]]
No, I said that to suggest cells are capable of ‘self’ replication is to suggest that they can produce hteir own energy necessary for the changes.
[[I’m still waiting for you or someone to show us the magic flaw in descent with modification. Bring it on. Imagine the look on the faces of the tens or thousands of PhD biologists, chemists, physicists, astronomers, geologists, when you show up with your strenuous look]]
As I said it wouldn’t even phase them as they’ve been brought the scientific evidence that it is biologically impossible, yet they still beleive that a single chance of 10 to hte 300’th or so power is enough to account for hte trillions of other biologically impossible changes. If there’s a ‘glimmer of hope’ somehwere, anwhere, then to them it’s entirely possible the vast vast intelligently designed systems with hteir vast highly specified complexities was created through such a dim weak probability of chance. Hence 150 years of insistence that the biolgical infeasible system is feasible.
Interesting.
Why does the date matter? I think that it shows that you have not shown what you thought to have shown.
Dr. Rebek announced back in 1990 that he and his team had created these ‘self replicating molecules’. But after a couple of NY Time articles etc., I can not find that much else happened with his work from him or others directly along those lines or linearly following it..
Apparently all that he produced of this substance was a small vial of it, and no one else ever got to analyze or confirm that it was what it was, or that there were not or may be other causes origins etc for how that compound came to be.
Also, other non-creationists scientists have disagreed with him and his findings, or have re characteristized amino adenosine triacid ester (AATE) as only mimicking certain process that they think happens within the cell.
It could have been yet another case of an over-exuberant scientist making a pre-mature claim.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.