Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,881-9,9009,901-9,9209,921-9,940 ... 22,141-22,158 next last
To: AdmSmith; BeauBo

THe link definitely shows the Russian ship Sparta in the Mediterranean Sea between Spain and Algeria. It must have made good time to get from the Atlantic Ocean off Portugal to where it is shown now, especially if it is having engine problems. I recently saw a nature program on public TV about Portugal, and they have some nasty cliff areas with hundred foot high waves that a few suicidal surfers dare to ride. I was wondering if the ship was there and might crash.


9,901 posted on 12/24/2024 3:42:25 AM PST by gleeaikin (in Question authority as you provide links)
[ Post Reply | Private Reply | To 9878 | View Replies]

To: AdmSmith

“the Ursa Major just prior to sinking”

Sinking!

I guess it really was sick.

Three Russian oil tankers down in the Black Sea as well, just this month.

Russian civil aviation is also suffering from a similar increase in industrial accidents resulting from deferred maintenance or waiving of safety standards; under the pressures of sanctions, resource constraints and OPTEMPO (…and possibly vodka. Yes, probably vodka too.)

I don’t think they will get an extension of their deadline to evacuate Tartus, just because one of their ships couldn’t make the trip.


9,902 posted on 12/24/2024 3:43:14 AM PST by BeauBo
[ Post Reply | Private Reply | To 9899 | View Replies]

To: FtrPilot

F/A-18F Shot Down by Friendly Cruiser Was in The Middle of a Refueling Mission
The friendly fire incident in the Red Sea also involved the most advanced Ticonderoga class cruiser in Navy service that had just been upgraded.
https://www.twz.com/sea/f-a-18f-shot-down-by-friendly-cruiser-was-in-the-middle-of-a-refueling-mission


F/A-18F Was Shot Down by Friendly Fire as Jets Were About to Land on The Carrier
The friendly fire incident also came amid a sustained Houthi drone and missile attack targeting the Harry S. Truman Carrier Strike Group.
https://www.twz.com/air/f-a-18f-was-downed-by-friendly-fire-as-jets-were-about-to-land-on-the-carrier


Syria’s Air Defenses Helped Make The F-22A Raptor a Reality
Air Force Secretary Frank Kendall recalled how the F-22’s cost was justified during the dawn of the post-Cold War era.
https://www.twz.com/air/syrias-air-defenses-helped-make-the-f-22a-raptor-a-reality


Ukrainian M1 Abrams Commander Talks Tank’s Major Vulnerabilities, Advantages in Combat
The M1 commander highlighted glaring issues with the M1 that make it vulnerable on a drone drenched battlefield, while also praising its resilience.
https://www.twz.com/news-features/ukrainian-m1-abrams-commander-talks-tanks-major-vulnerabilities-advantages-in-combat


North Korea to Send More Troops to Fight For Russia Against Ukraine: South Korean Intel
Ukraine Situation Report: North Korean casualties in Kursk are climbing but more troops and weapons may be on the way.
https://www.twz.com/news-features/north-korea-to-send-more-troops-to-fight-for-russia-against-ukraine-south-korean-intel


9,903 posted on 12/24/2024 3:53:24 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9884 | View Replies]

To: AdmSmith

“The Kremlin may be setting information conditions for a false flag in the pro-Russian breakaway region of Transnistria likely in a continued attempt to destabilize Moldova and hinder its integration into European Union (EU).”

What are they (Russians) going to do at this point?

They can’t reinforce Transnistria, they are cut off. They can’t resupply to keep the lights on anymore. Ukraine has expressed an interest in sending some boys in, to blast the remaining stranded Russian troops out, if asked.

Eventually, the locals will likely request safe passage out for the Russian garrison, so they can rejoin Mother Moldova, and warm themselves by her fire.


9,904 posted on 12/24/2024 3:59:48 AM PST by BeauBo
[ Post Reply | Private Reply | To 9897 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Turn North Koreans Against Each Other With Drones ]


Today [ Dec 23, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, the North Korean forces find themselves thrust into a conflict shaped by technologies and tactics far beyond their experience. Their struggle to contend with the relentless presence of drones reveals a dangerous gap in preparedness, setting the stage for a harsh lesson in the realities of modern warfare.

After a week of relentless human wave assaults by the North Korean soldiers, they failed to achieve their primary goal of retaking a significant part of the Kursk salient.

Similarly, the Russians cannot present the limited gains as a victory, because it would mean admitting to the integration of foreign North Korean troops to fill their ranks, as domestic recruitment fails to compensate for the Russian losses.

The failure of the North Korean assaults can be largely attributed to their troops’ lack of experience with modern warfare, and their inability to adapt.

North Korea’s decades of isolation from the outside world, with minimal external influence or exposure, have left its military doctrine severely outdated, rooted in strategies dating back to the Korean War, over 70 years ago.

One of their largest shortcomings has shown to be the inability to adapt to the unprecedented use of drones, which take a central role in modern Ukrainian combat operations.

Their limited understanding of advanced reconnaissance and precision strikes, made possible by Ukrainians’ extensive drone warfare, allowed Ukrainian forces to inflict devastating losses on every assault. As a result, North Korean units performed even worse than even the least capable Russian assault units.

During their initial assaults, North Korean forces failed to recognize drones as a serious threat, advancing slowly across open fields, underestimating the danger from the skies. The soldiers did not attempt to maneuver or evade FPV drone strikes, while Ukrainian drone operators, skilled in targeting fast-moving troops, exploited their vulnerabilities.

This lack of awareness made the North Koreans easy targets, with even inexperienced Ukrainian drone operators using single FPV drones, to decimate large infantry formations.

After suffering heavy losses in their initial encounters with drones, North Korean commanders attempted to adapt by setting up observation points and instructing soldiers to listen for buzzing sounds and scan the skies.

However, these efforts had little impact on the Ukrainian drone operators, as the North Koreans lacked electronic warfare countermeasures or other advanced systems, leaving them vulnerable to continued drone strikes.

Combat footage from the area shows North Korean soldiers repeatedly failing to protect themselves from drone strikes. Instead of attempting to maneuver, take cover, or lie down to reduce exposure, the soldiers often panicked, and tried to shoot down the drones with small arms fire while standing in place.

Ukrainian drone operators took advantage of this, and repeatedly maneuvered their drones right in between the confused troops, causing the North Korean to kill each other, as they tried and failed to shoot down the drones.

Additionally, the North Korean soldiers stationed themselves on the outer edges of forests, remaining bunched together instead of moving deeper into the woods. By doing so, they missed an opportunity to use the dense trees and terrain to disrupt drone signals, which could have reduced the effectiveness of Ukrainian strikes.

This tactical error allowed Ukrainian drone operators to target and eliminate large groups of North Korean troops with just a few drone strikes, even after the soldiers had reached their objectives within the forests.

To further exploit the North Korean soldiers’ lack of familiarity with drones, the Ukrainians attached small stuffed Christmas toys to some of their drones.

This tactic caused additional confusion among the North Korean troops, who wasted precious seconds trying to comprehend why a toy was flying toward them. By the time they realized the threat, it was too late; these drones effectively struck, eliminating large numbers of soldiers in a single attack.

Overall, the North Koreans continued reliance on outdated assault tactics, coupled with their inability to adapt to modern warfare, resulted in catastrophic losses across all their units.

South Korean Military Intelligence attributed the high casualties to their inexperience with drone warfare and their unfamiliarity with the open terrain, as North Koreans are more accustomed to the more mountainous terrain of Korea.

To address these issues, Russian and North Korean commanders may need to pause operations, to train their troops in counter-drone measures, and overhaul North Korean combat tactics, a process that could delay the Kursk counteroffensive by weeks or even months.


9,905 posted on 12/24/2024 4:08:14 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9902 | View Replies]

To: PIF

“Ukrainian M1 Abrams Commander Talks Tank’s Major Vulnerabilities”

Swarms of drone, and Russian drones now have night vision.


9,906 posted on 12/24/2024 4:19:56 AM PST by BeauBo
[ Post Reply | Private Reply | To 9903 | View Replies]

To: BeauBo
It seems the Russians are feeling quite sad about this (sinking of the ursa major).

https://x.com/wartranslated/status/1871509610827571478


9,907 posted on 12/24/2024 5:42:53 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9902 | View Replies]

To: BeauBo
🇵🇱 Poland has begun testing a three-stage ballistic missile that will reach Moscow From the Polish territory In just a few minutes

https://x.com/intermarium24/status/1871370651451486382

Poland is serious about self defense.

9,908 posted on 12/24/2024 5:54:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9907 | View Replies]

To: All
Some ruzzian bloggers are claiming sabotage.


9,909 posted on 12/24/2024 5:57:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9907 | View Replies]

To: BeauBo
🇷🇺 The Russian army aims to seize a foothold on the right bank of the Dnipro in Kherson Oblast, but there are no plans to storm the city of Kherson itself, per Southern Defense Forces spokesman Vlad Voloshyn.

"5-7 infantry assaults occur daily along this axis," he said, calling it preparation for a potential foothold.

https://x.com/NOELreports/status/1871549675381408056

I believe this is preparation for negotiation.


9,910 posted on 12/24/2024 6:01:56 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9909 | View Replies]

To: FtrPilot

Sad.


9,911 posted on 12/24/2024 6:06:55 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9907 | View Replies]

To: FtrPilot

Kremlin snuff box, 12/24/24
https://t.me/s/kremlin_secrets

A Russian ship crashed in the Mediterranean Sea. What was on board?

It is no longer a big secret that the Russian merchant ship Ursa Major crashed in the Mediterranean Sea (in international waters between Algeria and Spain). The day before there was an explosion on board the ship, which was confirmed by our sources.

The interlocutors reluctantly noted that negotiations were actively underway with the Turkish side and the new Syrian authorities about the possibility of the ship calling at one of the Syrian ports.

It is preliminary known that the cargo ship was supposed to deliver some weapons to Syria, and on the way to Vladivostok, pick up secret cargo from Syria. What exactly is not specified.

At the same time, the interlocutors expressed regret over the loss of the vessel. Previously, sources say that it was planned to deliver certain components for armored and aircraft equipment, as well as shells, to Syria. However, all this, of course, is unofficial.

Now the Kremlin has high hopes that Russian military bases on Syrian territory will be preserved. According to our information, negotiations with the participation of Ramzan Kadyrov are not going well, but there is no point in drawing any conclusions just yet.

One source suggested that the explosion on the Ursa Major could have been planned. Since almost all crew members were rescued, the details of the explosion remain to be sorted out.


9,912 posted on 12/24/2024 6:12:58 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9909 | View Replies]

To: FtrPilot

I will put this, what could possible go wrong with a river crossing to a prepared defense.

I would imagine the boats they will be using are relatively easy targets for drones and cluster munitions

I say go for it


9,913 posted on 12/24/2024 6:15:24 AM PST by blitz128
[ Post Reply | Private Reply | To 9910 | View Replies]

To: PIF
Slovakia was offered an alternative for Russian gas, but Fico refused. Instead, Fico went to Moscow anyway and came with nothing back for Slovakia. And we really have to emphasize:

Nothing for Slovakia

Nothing for Slovakia doesn't mean nothing for him, and this has been the only point for him being there. Fico is only the latest example that populists only deliver for themselves and not the sheep who vote for them. The most telling part is that what he does will also antagonize the incoming Trump administration, which will try its best to sell American LNG products.

In any case, Russian gas supplies will stop January 1st. Ukraine made the case quite clear not to renew the contracts. Instead of finding common ground with Kyiv, Brussels and Washington, Fico chose Moscow, and soon Slovakia will pay the price for this foolish decision.

https://x.com/Tendar/status/1871559455982092708


9,914 posted on 12/24/2024 6:39:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9910 | View Replies]

To: FtrPilot

Caption:
Fico at 5’4” seen here towering over the diminutive Putin.


9,915 posted on 12/24/2024 7:25:33 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9914 | View Replies]

To: PIF

Fico is 6 foot.


9,916 posted on 12/24/2024 7:36:18 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 9915 | View Replies]

To: FtrPilot

Fico and his Party (SMER) are super corrupt. He had to resign previously over a corruption scandal, and his first order of business when he regained power, was to clear the field for more, by doing away with Government watchdogs/investigators/prosecutors, and taking over the State media to control their coverage.

He was shot five times in a failed assassination attempt in May.


9,917 posted on 12/24/2024 8:02:10 AM PST by BeauBo
[ Post Reply | Private Reply | To 9914 | View Replies]

To: ansel12

It was a spoof, a joke.


9,918 posted on 12/24/2024 12:28:02 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9916 | View Replies]

To: PIF

I figured that but not everyone knows their heights, especially of the obscure Slovakia guy.


9,919 posted on 12/24/2024 12:55:33 PM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 9918 | View Replies]

To: PIF; BeauBo; FtrPilot; gleeaikin; ETCM
What is Going on With Shipping?: Russian Cargo Ship Ursa Major Sinks in the Mediterranean | Fifth Russian Commercial Vessel Lost

In this episode, Sal Mercogliano—a maritime historian at Campbell University (@campbelledu) and former merchant mariner — discusses the loss of Russian freighter Ursa Major in the Mediterranean en route to Vladivostok.

https://www.youtube.com/watch?v=5N_eHRNpAPo

9,920 posted on 12/24/2024 1:37:36 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9912 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,881-9,9009,901-9,9209,921-9,940 ... 22,141-22,158 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson