Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,741-6,7606,761-6,7806,781-6,800 ... 19,221-19,229 next last

6,761 posted on 09/30/2024 1:50:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6742 | View Replies]

To: PIF
Russian blogger

Alla Pugacheva’s husband has bad dreams about Putin. Our insider information about the Prima Donna's plans is confirmed

The information that foreign agent Maxim Galkin has changed his mind about selling his apartment in Moscow has made many happy. They say that the enemy of our country cannot even get rid of real estate. But in this situation, everything is not as it seems at first glance.

Galkin’s decision not to sell the apartment is confirmed by our insider information - Alla Pugacheva and her husband are planning to return to Russia. And soon - at the end of this year or at the beginning of the next.

“Lately, Maxim has been talking more and more about his imminent return home. In a narrow circle, he has even started to joke quite harshly - they say that he constantly dreams that he woke up in Moscow, and Putin “is not there and never was.” Or that Putin is lying in a coffin. Such bad dreams, but they make him happy. It is clear that Maxim has no doubts about his return to Russia,” a close friend of Pugacheva and Galkin, who now lives in Israel, told us.

According to another source in the Prima Donna's entourage, Galkin came to the conclusion that Vladimir Vladimirovich “will soon be gone” (it is unclear what is meant by these words, but it is obvious that our fugitives hope that, at a minimum, the president will lose power) as a result of communicating with Pugacheva.

“Allochka often calls Moscow. She communicates with very important people there, among them there are military personnel and people who work in the Kremlin. After each such conversation, she is always very pleased and even gradually collects things that she will take with her to Russia,” notes Alla Borisovna’s friend.

At the same time, the singer continues to urge her friends to leave Russia for a while, especially from Moscow and St. Petersburg. She claims that these cities will allegedly soon be especially dangerous, and her “general friends are taking their families out.” None of our sources know what the danger might be. But everyone says that “it is somehow connected with the war.” It must be said that the Prima Donna's previous warnings that it would be dangerous in Russia have, unfortunately, been confirmed. Which resulted in strikes on Moscow and elsewhere.

We asked our acquaintances in the Kremlin and the Ministry of Defense to comment on this information. All of them have so far refused to comment. And they deny that generals are taking their families out of Moscow and St. Petersburg.

https://t.me/s/kremlin_secrets

There is more and more negative writing about Putin in Russia these days.

6,762 posted on 09/30/2024 2:22:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6658 | View Replies]

To: PIF; SpeedyInTexas
Russian blogger

The Kremlin is artificially strengthening Belousov, but there are also dissatisfied people in the Defense Ministry

The day before, Dmitry Peskov said that the conditions for the use of nuclear weapons , according to the new nuclear doctrine, will be determined by the Defense Ministry. “This is rather the prerogative of our specialists, our military. They are closely monitoring what weapons are used and how they are used. They are the ones recording the direct involvement of the countries of the collective West in the conflict around Ukraine, and they will not weaken their attention,” Peskov said.

Our source in the Defense Ministry, close to Sergei Shoigu, pointed out a certain paradox. “Everyone understands that the decision will be made by the president. If we were to strike with a nuke every time the military wanted, we would have already destroyed the planet. There are different people in the Defense Ministry - there are hawks, and there are calmer and more thoughtful ones,” our interlocutor said.

It is noteworthy that Belousov specified at a meeting with military correspondents that the final decision will be made by the president. According to our source in the Ministry of Defense, after the general purges, Belousov’s authority in the army has not been fully strengthened. “The Presidential Administration is artificially strengthening Belousov. And at the same time shifting responsibility onto him. But this will not work,” the source said. According to him, the current minister's main problem is the lack of a reliable team. “Some people work in fear that they will be approached. But no one sincerely supports Belousov,” the general noted.

https://t.me/kremlin_secrets/4715

6,763 posted on 09/30/2024 2:27:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6762 | View Replies]

The Insider has obtained access to hundreds of official documents related to Russian opposition leader Alexei Navalny’s death in the Polar Wolf penal colony in the Russian Far North on Feb. 16, 2024. Officially, Navalny’s death was attributed to natural causes, and Russia's Investigative Committee stated in July that the case “does not have a criminal nature.” However, the contents of the documents in The Insider's possession demonstrate that Russian authorities consistently removed references to symptoms Navalny was documented to have been suffering — symptoms that did not fit with the Russian state's official cause of death. As medical experts confirm, these symptoms clearly indicate that Navalny was poisoned.

Further evidence, albeit indirect, of the use of a poisonous substance can be observed in the authorities’ reluctance to release Navalny’s body for several days following his death, along with their refusal to allow for an independent examination of biological samples. While suspicion surrounding the true cause of Navalny’s death arose almost immediately after it was announced, it was not until now that the fact of Navalny’s poisoning has been confirmed by official documents.

https://theins.ru/en/politics/274926

6,764 posted on 09/30/2024 2:38:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6763 | View Replies]

To: AdmSmith

The problem with printing money…

Nobody wants to be stuck holding your currency, if you are devaluing it. A big reason why demand has collapsed for Russian Government bonds, is that they would be paid back in rubles, which everyone now expects to be worth less in the future.

The ruble is just another casualty of Putin’s sickness. And with it goes the value of the savings of the whole population.


6,765 posted on 09/30/2024 3:29:42 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6759 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Footage: Defeated Russian Soldiers Jump From Top Floors to Escape ]


Today [ Sept 30 ], there are a lot of updates from the Toretsk direction.

Here, Russian forces attempted to advance from two assault vectors: the northern flank of the city and the city center. In response, Ukrainian forces launched counterattacks that successfully drove the Russians out of northern Druzhba and are now pushing them out of the center of Toretsk.

On the northern flank of Toretsk, Russian forces are attempting to seize control of the outskirt town of Druzhba. Control of Druzhba is crucial, as it would provide Russian troops with a staging ground for northern advances to semi-encircle Toretsk. Aware of this, the Ukrainian command is launching counterattacks to challenge the Russian presence and disrupt their plans.

Recently, Ukrainian fighters managed to weaken Russian positions in northern Druzhba with powerful mortar and FPV drone strikes before deploying into the town. The heavy damage to houses in this area forced Russian fighters to flee, exposing them to the advancing Ukrainians. After intense mortar and drone fire on other Russian positions, a small squad of 3 Russian fighters was cornered in a basement.

Meanwhile, the remaining Russian troops in the open were eliminated by Ukrainian drone operators. The Ukrainian forces successfully forced the squad in the basement to surrender, taking them as prisoners of war.

Ukrainian control of northern Druzhba will prevent the Russian forces from launching flank attacks on Toretsk. Meanwhile, the captured Russian fighters can reveal vital information about the Russian plans, further ruining the plans of the Russian command.

In the center of Toretsk, Russian forces entered the high-rise building complex, sparking fierce fighting over the area. Their goal is to capture the high rises and establish fire control over the surroundings. Achieving this would enable Russian troops to advance along Third May Lane, potentially splitting the Ukrainian defenses in half. This move is intended to coordinate with their planned flanking attacks from the north.

After Russian forces entered the southern part of the high-rise area, intense fighting broke out with Ukrainian fighters. Once the Russians established positions in one of the buildings, the Ukrainians deployed a remotely operated ground drone packed with explosives to breach a wall, strike Russian positions, and enable their stormtroopers to launch a counterattack.

Footage from the Ukrainian Lyut Brigade shows ongoing small-arms fire engagements at close range. The fighting escalated as Ukrainians and Russians battled for control of every floor. One Russian soldier attempted to escape by climbing down the balconies, but tragically fell to his death from the 6th floor, a height of 20 meters.

The dynamic nature of the fighting in this part of the city prevents the Russians from fully controlling the high-rise area, leaving it contested. Additionally, the Russian failure to establish fire control around the high-rises allowed Ukrainian forces to conduct reconnaissance missions along Central Street, deep behind Russian lines.

This forced the Russians to shift focus, attempting to stabilize the situation by expanding control around Central Street and advancing towards Darvina and Pusharenko streets. Their advance was aided by the fact that Ukrainian positions in this area consisted of small residential houses, which Russian stormtroopers initially captured, but were quickly halted by Ukrainian fighters.

Overall, The Russian plan to quickly advance through Toretsk and split the city into two pockets was canceled, due to unexpectedly strong Ukrainian resistance in the tactically important high-rise area and the counterattack at Druzhba.

As the Russian forces struggled to secure the high-rise buildings, the command had to redirect troops to protect the flanks along Central Street, preventing a potential frontline collapse. Ukrainian counterattacks finally brought the Russian offensive to a halt, after months of gradual slowing. The front has stabilized, shifting the initiative in favor of the Ukrainians.


6,766 posted on 09/30/2024 4:17:57 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6755 | View Replies]

To: PIF; All

“This $2.4 Billion Lithium Mine Is Caught Between Russia and the West”

“U.S. suspects Rio Tinto’s project in Serbia has been hit by a Russian disinformation campaign”

“This summer, tens of thousands of protesters in Serbia took to the streets to oppose a proposed lithium mine. Fueling the protests: suspected Russian disinformation.

Russia is likely playing a major role in stoking opposition to the project, the U.S. and Germany say, seeking to undermine the development of what could be a key source of lithium for Europe’s automakers.

Conspiracy theories and provocations abound online, including that the lithium project will secretly mine uranium, that it will poison Serbia’s drinking water and that sulfuric acid rain will fall over the capital, Belgrade, if the mine is built. Rio Tinto, the mining giant that owns the project, says these claims are false and that it has to regularly rebut them.

The mine has become an unlikely flashpoint in U.S.-Russia relations. The West has been trying to secure the minerals needed for the energy transition by decreasing its dependence on Chinese-dominated supply chains. Meanwhile, Moscow is seeking to retain influence in a strategically important region by preventing Serbia from fostering closer ties with the West, analysts say.

Following a review of social-media posts and newspaper articles related to the mine, the Global Engagement Center, a State Department office aimed at countering disinformation abroad, “considers it to be highly likely that the Kremlin has played a role in spreading this disinformation,” a spokesperson said.

Christopher Hill, the U.S. ambassador to Serbia, said pro-Kremlin provocateurs built support for anti-lithium protests through official and unofficial channels. While he says there are differences of opinion in the country about the mine, “it’s clear that Russia seized an opportunity here to try to drive a wedge between Serbia and the West.”

Germany also believes Russia is involved in the campaign against the project. “We have observed clear signs of inauthentic amplification from the Russian disinformation ecosystem,” a government official said.” [Did Willie Brown’s mistress write that sentence?]

[PAYWALL] https://www.wsj.com/business/this-2-4-billion-lithium-mine-is-caught-between-russia-and-the-west-a785be24?mod=lead_feature_below_a_pos3


6,767 posted on 09/30/2024 5:29:40 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6765 | View Replies]

To: PIF; All

“Israel Making Raids in Lebanon to Set Up Possible Invasion, Officials Say”


6,768 posted on 09/30/2024 6:30:46 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6767 | View Replies]

To: BeauBo; AdmSmith; SpeedyInTexas; blitz128; FtrPilot; PIF; MalPearce; Zhang Fei; alexander_busek; ...

Given Russia’s use and outflow of gold reserves, does anyone have information on Russian gold mining past and current? Could shrinking gold supply and production be one reason Russians are promoting the idea of Russia taking back Alaska? And of course there is all that Alaskan oil to be seized. Also, does China have any gold sites to mine and develop?


6,769 posted on 09/30/2024 6:40:51 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 6753 | View Replies]

To: PIF; All

Of course a shutdown was going to be bad for Republicans.

“Speaker Mike Johnson needed to convince former President Donald Trump that a shutdown could hurt their party on Election Day even as the Republican presidential nominee was itching for a fight with Democrats over cracking down on non-citizens voting in elections.

So in a recent sit-down at Mar-a-Lago, Johnson showed Trump polling warning a shutdown could zap the GOP’s House majority, two sources close to the speaker said. Then, to drive home the point, Johnson pulled out a set of photographs of the GOP incumbents – many of whom Trump liked – who could lose.”


6,770 posted on 09/30/2024 6:45:47 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6768 | View Replies]

To: PIF; All

Ground drone hit by the air drone.

“Russian ground drone destroyed by FPV strike. “

https://x.com/bayraktar_1love/status/1840479942645006555


6,771 posted on 09/30/2024 6:58:09 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6770 | View Replies]

To: PIF; All

Droning the enemy drone.

“Here is what the first recorded case of downing an enemy Mavic using a drop device looks like.”

https://x.com/wartranslated/status/1840740023479554091


6,772 posted on 09/30/2024 6:59:44 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6771 | View Replies]

To: PIF; All

“An attempt to storm the “Petr Godovanets”, one of the gas production platforms in the Black Sea controlled by Russia.

The crews of the special unit “Dozor” of the State Border Guard Service and the GUR are working.”

https://x.com/wartranslated/status/1840690526066028843


6,773 posted on 09/30/2024 7:03:13 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6772 | View Replies]

To: SpeedyInTexas

New Polish law allow illegals crossing its border to be shot on sight.


6,774 posted on 09/30/2024 7:03:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6771 | View Replies]

To: PIF; All

I can report the special military operation is still going on .. and all going according to plan.

“Denis Kulaga, a Z-war correspondent for the Russian newspaper Izvestia, was wounded near Chasiv Yar in the Donetsk region. The moment of injury was captured on video, showing an FPV drone striking as he was traveling on a quad bike. Kulaga sustained shrapnel wounds, burns, and fractures to both legs.”

https://x.com/NOELreports/status/1840738386401018278


6,775 posted on 09/30/2024 7:06:48 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6773 | View Replies]

To: PIF

Golden opportunity for the Polish military to hone their ‘droning’ abilities.


6,776 posted on 09/30/2024 7:08:10 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6774 | View Replies]

To: PIF; All

Join EU and NATO...

“Croatian Prime Minister Andrej Plenković stated that Putin has unintentionally become the biggest catalyst for the expansion of the European Union. His 2022 invasion of Ukraine has driven more countries to seek EU membership.”

https://x.com/NOELreports/status/1840669382604656849


6,777 posted on 09/30/2024 7:09:35 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6776 | View Replies]

To: SpeedyInTexas

Golden opportunity for the Polish military to hone their ‘droning’ abilities.


Also good marksman practice where applicable - bullets are cheaper than drones


6,778 posted on 09/30/2024 7:10:43 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6776 | View Replies]

To: BeauBo

They will introduce a new currency when 1 dollar >100 Ruble, the name of the currency will be Rubble.


6,779 posted on 09/30/2024 7:12:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6765 | View Replies]

To: SpeedyInTexas

Video:

Reporter: What happens to me if I break through your wall? What happens to me next?
Man: You’ll die like a dog.

https://www.youtube.com/watch?v=u6Q5DJTDyoQ

Russia’s hybrid Polish Border War: Russia pushes migrants through Belarus into Poland to destabilize it. While crime, unemployment, and so on plague the EU, Poland’s stance has kept the country stable and livable. The city streets look like European ones form 50 years ago - clean, uncluttered sidewalks.


6,780 posted on 09/30/2024 7:35:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6776 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,741-6,7606,761-6,7806,781-6,800 ... 19,221-19,229 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson