Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,621-5,6405,641-5,6605,661-5,680 ... 7,861-7,864 next last
To: AdmSmith; SpeedyInTexas; PIF

“One of its (The Russian news site Vestka) contacts said that when the news of the initial stages of Ukraine’s move into Kursk took place on Tuesday, Aug. 6, it was met with apathy amongst officials who did not consider it to be a serious threat.”

It is now apparent that the Kursk offensive has caused Russian to redeploy units out of Ukraine and back into Russia. Ukrainian forces have already begun a counter-offensive in an area of Kharkiv, from which Russia pulled forces away to Kursk.

ISW reports (22Aug):

“The Russian military command recently redeployed elements of at least one Russian airborne (VDV) regiment (56th VDV Regiment, 7th VDV Division), from western Zaporizhia Oblast in response to Ukraine’s incursion into Kursk Oblast, possibly in an effort to stabilize the lines and improve command and control (C2) over Russian conscripts...

…Elements of the 56th VDV Regiment have been operating in western Zaporizhia Oblast since at least Summer 2023. ISW has also observed proprietary, commercially-available data appearing to support reports of these redeployments…

…Russian sources recently amplified footage purportedly showing elements of the 11th VDV Brigade allegedly leading conscripts out of an encirclement in an unspecified area in Kursk Oblast, and ISW observed elements of the 11th VDV Brigade operating in the Chasiv Yar direction in early July 2024.

The scale of the redeployment of the 56th VDV Regiment is unclear from available information in the open source, although this reported redeployment is consistent with ISW’s observation that Russia has been pulling forces from less critical sectors of the frontline such as western Zaporizhia and Kherson oblasts.

The Russian military command notably redeployed elements of the Russian 810th Naval Infantry Brigade (Black Sea Fleet [BSF]) and elements of two unspecified VDV battalions from the Kherson direction to Kursk Oblast, and ISW has also observed claims that elements of the 810th Naval Infantry Brigade were operating near Vovchansk, Kharkiv Oblast in June 2024.

The Russian military command generally regards VDV and naval infantry elements as “elite” forces (even though many Russian elite units have lost their eliteness over the course of the Russian full-scale invasion of Ukraine) and tends to deploy these forces to prioritized directions. The scale of such redeployments serves as a greater indicator of the Russian military’s prioritization, however. ISW continues to assess that Russian President Vladimir Putin and the Russian military will likely continue prioritizing Russian offensive operations in eastern Ukraine – namely in the Pokrovsk and Toretsk directions.

The Ukrainian General Staff notably observed a decrease in Russian combat operations in western Zaporizhia and Kherson oblasts on August 22. The effects of redeploying elements of the 56th VDV Regiment and other elite elements from southern Ukraine will also depend on the scale of the redeployments. The Russian military command may be redeploying limited numbers of elite forces to improve C2 in Kursk Oblast and oversee inexperienced conscripts.

The Russian military command reportedly heavily committed elements initially intended for the Russian offensive effort in northern Kharkiv Oblast to the defense of Kursk Oblast…

…Russian opposition outlet Novaya Gazeta reported on August 19 that appeals from relatives on Russian social media, reports about missing soldiers, and OSINT assessments indicate that Russia has committed elements of the following units to fighting in Kursk Oblast: the 488th Motorized Rifle Regiment’s 17th and 18th battalions (144th Motorized Rifle Division, 20th Combined Arms Army [CAA], Moscow Military District [MMD]), the 252nd Motorized Rifle Regiment (3rd Motorized Rifle Division, 20th CAA, MMD), the 102nd Motorized Rifle Regiment’s 31st Battalion (150th Motorized Rifle Division, 8th CAA, SMD), the 9th Motorized Rifle Regiment (1st Donetsk People’s Republic [DNR] Army Corps [AC]), the 143rd Motorized Rifle Regiment (127th Motorized Rifle Division, 5th CAA, Eastern Military District [EMD]), Chechen Akhmat Spetsnaz units, 810th Naval Infantry Brigade (Black Sea Fleet), 22nd Motorized Rifle Regiment (72nd Motorized Rifle Division, 44th AC, Leningrad Military District [LMD]), 25th Motorized Rifle Brigade (6th CAA, LMD), 200th Motorized Rifle Brigade (14th AC, LMD), Nizhnyi Novgorod’s “Kulibin” detachment, the DNR “Pyatnashka” Brigade, “Veterany” 60th Motorized Rifle Brigade’s “Oleg Mamiev” 3rd reconnaissance and assault detachment and “Otvazhnye” assault squad (Russian Volunteer Corps), unspecified BARS volunteer formations, and the 5th Anti-Aircraft Missile Brigade (6th Air Defense Army).

Novaya Gazeta noted that elements of the 22nd Motorized Rifle Regiment, “Veterany” 60th Motorized Rifle Brigade, and the 25th Motorized Rifle Brigade that were committed to Kursk Oblast were either recently deployed or about to deploy to Vovchansk (northeast of Kharkiv City).

ISW has observed that significant redeployments of elements of the Northern Grouping of Forces (which is responsible for the Kharkiv direction) to Kursk Oblast suggest that the Russian military command has determined that disruption to the offensive operation in northern Kharkiv Oblast is a necessary sacrifice to appropriately respond to the Ukrainian incursion while avoiding redeployments from higher priority sectors of the frontline. (Ukraine has apparently detected the weakening of Russian forces there, and has recently begun a counter-offensive in Kharkiv).

The Ukrainian incursion into Kursk Oblast will continue to generate theater-wide operational pressures on Russian forces, and it is unlikely that the Russian military will be able to restrict significant disruptions to just the Northern Grouping of Forces particularly if and when it undertakes to expel Ukrainian forces from Kursk.”


5,641 posted on 08/22/2024 9:27:28 PM PDT by BeauBo
[ Post Reply | Private Reply | To 5588 | View Replies]

To: BeauBo

and the link to “Russian Offensive Campaign Assessment, August 22, 2024”

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-august-22-2024


5,642 posted on 08/22/2024 11:09:06 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5585 | View Replies]

To: AdmSmith

5,643 posted on 08/22/2024 11:17:56 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5589 | View Replies]

To: SpeedyInTexas

“RUSSIAN Ruble Starts to Collapse” (Joe Blogs, YouTube, 22 Aug 2024)

Since the start of Ukraine’s offensive in Kursk, the value of the ruble has been declining (now about 92.5 to the dollar), after having been held stable all year through currency controls and Central Bank purchasing support. It appears that the Russian Central Bank has reduced its intervention in the market (buying rubles to prop up the exchange rate).

This may indicate that they are now constrained in their remaining available financial reserves, and cannot, or choose not to, keep using their reserves to hold the price of the ruble steady (even though the market in the ruble is much smaller today, than when it used to be freely traded before the current harsh capital controls, requiring less buying to effect the price).

In addition to the recent 8% decline in the ruble, July’s report indicates that inflation in Russia continues to accelerate - officially 9.1% in July, up from 8.6% in June (with the Central Bank’s target being 4%). Food price inflation was higher, rising officially to over 10%.

Benchmark interest rates have already been raised to a nosebleed 18%, but continued acceleration in inflation makes another hike in September likely (expectation is a rise to 20%).

When Russian Government financial reserves decline to the point that they are unable to defend their currency, we are likely to see the anticipated death spiral in the value of the ruble, below the 200 to the dollar level, estimated to cause irreversible decline in Russia’s overall economy.


5,644 posted on 08/23/2024 2:49:25 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
Russian blogger:

Mobilization has a serious supporter. He is trying to influence Putin

Philosopher Alexander Dugin has conveyed to Vladimir Putin a request to “carry out a large-scale mobilization in order to defeat Ukraine and prepare well for a direct war with NATO.” Alexander Gelyevich recently spoke out in favor of a general mobilization on his Telegram channel. According to a source in the Kremlin, he simultaneously conveyed to the president a request to “declare a large and serious mobilization that will affect everyone in our country. So that we can defeat our enemies with all of Russia.”

Dugin suggests that Vladimir Vladimirovich mobilize at least 1.5-2 million people. And think about mobilizing some women who “could help the front.”

“The ideas are original, I would say, ambitious. I am not sure that all of them will be accepted. But Alexander Gelyevich is a serious person, so Vladimir Vladimirovich has familiarized himself with his ideas. The decision regarding mobilization – whether to carry it out and, if so (there are no decisions on this issue yet), then in what volumes – will be made by the president himself. After numerous consultations,” our interlocutor added.

The decision, as we wrote , will be in September.

https://t.me/kremlin_secrets/4555

Napoleon Bonaparte: “Quand l’ennemi fait un faux mouvement , il faut se garder de l'interrompre”

5,645 posted on 08/23/2024 4:01:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5532 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Ukrainians Cut Off Thousands of Russians From Retreat ]


Today [ Aug 23 ], there are a lot of new developments in the Kursk direction.

After the confirmed destruction of 3 bridges over the Seym River, as analyzed in our previous report, several military analysts anticipate that Ukrainian forces will now shift their focus to the western flank of the incursion.

In the coming days and weeks, their efforts are likely to concentrate on tightening control over the newly formed cauldron, where a significant number of Russian soldiers could find themselves encircled and cut off from retreat. This strategy aims to capitalize on the current momentum, potentially leading to further entrapment and surrender of Russian forces.

Ukrainian President Volodymyr Zelenskyy recently announced that Ukrainian forces have successfully expanded their zone of control in Kursk, deepening it from 28 to 35 kilometers and now covering approximately 1,250 square kilometers, including 92 settlements.

The potential capture of a bridgehead, bordered to the north by the Seym River, could further extend this area by additional 700 square kilometers, significantly bolstering the territory under Ukrainian control.

In recent days, military analysts have explored the strategic reasoning behind the staggered destruction of the 3 bridges over the Seym River. Instead of attacking all the bridges simultaneously, Ukrainian forces chose to destroy them over several days, when the first option would have increased the number of Russian forces cut off from their supply lines on the left bank of the river, creating an operational encirclement.

Analysts conclude that this approach was likely intended to offer Russian troops a window to withdraw, thereby minimizing unnecessary Ukrainian losses in battles for these territories.

By doing so, Ukrainian forces presented the Russian command with a difficult choice: either maintain their positions under increasingly untenable conditions, risking encirclement, or withdraw as many troops as possible before the situation deteriorates further.

With all 3 bridges now destroyed, isolating the cauldron has become a top priority for Ukrainian forces. Some Russian analysts have suggested that Russian troops might attempt to address the logistical challenges by deploying pontoon bridges, small barges, or inflatable boats. However, this area is already under close Ukrainian surveillance.

The first Russian pontoon bridges, set up approximately 3 kilometers north of Glushkovo, were swiftly destroyed by Ukrainian forces. This was confirmed by satellite imagery and NASA FIRMS data, which detects thermal anomalies on the ground in real-time, typically used for forest fire monitoring. Geolocated images of FPV drone attacks later surfaced, corroborating these strikes on the pontoon bridges and military engineering units.

These developments indicate that the pontoon bridge solution is unlikely to be a viable option for large-scale logistics, further complicating the situation for Russian forces.

Analyzing the northeastern section of the 700-square-kilometer area targeted by Ukrainian forces, it’s clear they are intensifying efforts to secure control over Korenevo and its surrounding areas to the west and southwest, extending up to the Seym River. This strategy aligns with the goal of establishing the river as the natural boundary for the territory under Ukrainian control.

This area offers clear strategic advantages for Ukrainian forces, allowing them to launch attacks from multiple vectors while maintaining extensive fire control from within Ukrainian territory. Securing this bridgehead with minimal battle attrition would mark a significant achievement.

However, pushing further north beyond the Seym River appears less practical. If we look at the topographic map we can see prominent elevated areas just north of the river, making them difficult for Ukrainian forces to capture and hold.

Therefore, it makes strategic sense for Ukrainian forces to establish the Seym River as the natural boundary of their controlled territory. In contrast, advancing into this area from Ukrainian territory allows them to move from higher ground, providing them with a significant tactical advantage.

Recent developments in the Tiotkino sector uggest that Ukrainian forces are initiating a multi-vector approach to advance on the cauldron. While Russian military analysts previously reported the destruction of several bridges across the Seym River in Tetkino and Popovo-Lezhachi to hinder Ukrainian advances from the international border, they have also confirmed that Ukrainian forces have consolidated their positions in Otruba and along the west bank of the river.

Recent geolocated footage shows a MiG-29 fighter jet delivering precision strikes with two JDAM-ER guided air bombs, reducing a Russian border post in Tiotkino village to rubble.

Additional geolocated images reveal further JDAM-ER strikes on Russian positions within Tiotkino. The use of both American and French glide bombs, observed in recent days, underscores the meticulous planning behind the Ukrainian offensive in Kursk. This operation was likely prepared in complete secrecy over several months, possibly even without the full knowledge of Western partners.

Overall, the recent sequential destruction of the 3 bridges over the Seym River, highlights a strategic decision by the Ukrainian command to maximize territorial gains while minimizing casualties. By isolating this entire area logistically, Ukrainian forces are setting the stage for concentrated efforts in the coming days and weeks to secure control over it. The Russians, facing significant challenges in maintaining supply lines to their trapped troops, will find it increasingly difficult to sustain their positions.

This approach suggests that the Ukrainian High Command is effectively achieving the primary objectives of the operation: creating a buffer zone to protect the Sumy region by preemptively securing the most likely route for a Russian attack, and simultaneously capturing a substantial portion of Russian territory. This captured territory could serve as a valuable asset in future negotiations.


5,646 posted on 08/23/2024 4:52:59 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5644 | View Replies]

To: AdmSmith

Time to send Dugin to the front, as they talked about earlier.


5,647 posted on 08/23/2024 4:54:25 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5645 | View Replies]

To: BeauBo; All

NATO ISR flights right now over the western Black Sea, just like yesterday right before Ukraine’s Nuptun strike on the Kerch rail ferry.


5,648 posted on 08/23/2024 5:04:18 AM PDT by marcusmaximus
[ Post Reply | Private Reply | To 5644 | View Replies]

To: PIF
🔥🔥The fire spread to kerosene tanks at the oil depot in Proletarsk, Russia, - rosZMI

The Russians themselves have just declared that it is an eternal fire.

https://x.com/tweet4Anna_NAFO/status/1826911969372184800

Location of the fires.


5,649 posted on 08/23/2024 5:19:05 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 5647 | View Replies]

To: FtrPilot

Such a good look, esp the laughter😎


5,650 posted on 08/23/2024 5:29:23 AM PDT by blitz128
[ Post Reply | Private Reply | To 5649 | View Replies]

To: FtrPilot

Russian Jets Damaged in Ukrainian Long-Range Drone Attack on Air Base
Images taken after the attack on Marinovka Air Base in Russia show several shelters containing Su-24s and Su-34s were affected by the strikes.
https://www.twz.com/news-features/russian-jets-damaged-in-ukrainian-long-range-drone-attack-on-air-base


Inflatable Ukrainian F-16 Decoy Emerges at Defense Show
The appearance of the decoy, from a Czech specialist, comes soon after the arrival of the first F-16s in Ukraine.
https://www.twz.com/air/inflatable-ukrainian-f-16-decoy-emerges-at-defense-show


Ship Full of Fuel Train Cars Detonates in Russian Port, Ukrainian Neptune Missile Suspected (Updated)
https://www.twz.com/news-features/ship-full-of-fuel-train-cars-detonates-in-russian-port-ukrainian-neptune-missile-suspected


Starlink Now Being Deployed on U.S. Navy Warships
Starlink is part of the Navy’s ambitious SEA2 program that aims to provide high-bandwidth resilient global connectivity for U.S. warships that will have major operational and morale benefits.
https://www.twz.com/sea/starlink-now-being-deployed-on-u-s-navy-warships


5,651 posted on 08/23/2024 6:01:58 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5649 | View Replies]

To: FtrPilot

I have a serious question
The usuals say lots of things here like
Failure of Ukrainian’s to prepare for micro er ah massive attack into Kharkiv is a sign that Ukraine is done or
Using western weapons in Russia is a red line but using nork, and Iranian munitions on Ukraine is not or
Everything is going according to plan, we never really wanted (insert xyz) that land anyways….

I keep hearing that the Ukrainian “incursion “ into Kursk is doomed because Putin can unleash 100s of thousands of conscripts on them because this is Russia land, but didn’t Russia annex all the Ukrainian land they are fighting in?

So isn’t that “russian land” the conscripts can already help “defend”?


5,652 posted on 08/23/2024 6:06:00 AM PDT by blitz128
[ Post Reply | Private Reply | To 5649 | View Replies]

To: blitz128; PIF; FtrPilot; marcusmaximus; BeauBo; SpeedyInTexas
“When in danger or in doubt, run in circles, scream and shout.”


5,653 posted on 08/23/2024 6:21:18 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5650 | View Replies]

To: AdmSmith

5,654 posted on 08/23/2024 7:11:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5587 | View Replies]

To: blitz128

Once upon a time the land belonged to UKR. So it is not Russian land, except taken by force.


5,655 posted on 08/23/2024 7:13:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5652 | View Replies]

To: AdmSmith

They believed that prayer would put out the fires, but instead they got worse.


5,656 posted on 08/23/2024 7:14:12 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5653 | View Replies]

To: PIF

Event: The U.S. Embassy in Kyiv assesses that during the next several days and through the weekend there is an increased risk of both nighttime and daytime Russian drone and missile attacks throughout Ukraine in connection with Ukraine’s Independence Day on August 24.

https://ua.usembassy.gov/security-alert-message-for-u-s-citizens-ukraine/


5,657 posted on 08/23/2024 7:44:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5655 | View Replies]

To: PIF

Maybe they mixed up the spell

https://buffy.fandom.com/wiki/Rat_transformation_reversal_spell


5,658 posted on 08/23/2024 7:47:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5656 | View Replies]

To: FtrPilot

“fire spread to kerosene tanks at the oil depot in Proletarsk ”

I believe that additional falling drone debris struck the oil depot in Proletarsk again last night. There have been a few waves of debris, keeping it hot.


5,659 posted on 08/23/2024 7:51:42 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5649 | View Replies]

To: BeauBo

Plus from the videos, it looks like the breeze keeps pushing the fire onto more & more storage tanks


5,660 posted on 08/23/2024 8:12:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5659 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 5,621-5,6405,641-5,6605,661-5,680 ... 7,861-7,864 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson