Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Update from Ukraine | Ukraine Takes ground on the East | Full forces yet to be used
Youtube.com ^ | 6-7-2023 | Denys Davydov

Posted on 06/07/2023 5:44:40 PM PDT by UMCRevMom@aol.com

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 last
To: eyedigress

“That is what a plant would do.”
LOL! You are silly & paranoid!


61 posted on 06/07/2023 9:48:40 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 57 | View Replies]

To: UMCRevMom@aol.com

Nothing good will come from this.

There is no Winner.

It was invited by our own government to test the will of Russia.

It is real and costing the lives of many.

Joe Biden opened the door to set a trap, It may not work the way he wanted.


62 posted on 06/07/2023 9:52:33 PM PDT by eyedigress (Trump is my President!)
[ Post Reply | Private Reply | To 56 | View Replies]

To: UMCRevMom@aol.com

All the people rooting for Ukraine here love it that biden and company are getting more wealthy continuing to rob taxpayers with money laundering operation in Ukraine.


63 posted on 06/07/2023 10:00:57 PM PDT by SACK UP
[ Post Reply | Private Reply | To 1 | View Replies]

To: UMCRevMom@aol.com

VIDEOS

1. In Belgorod, local residents support the rebels against Putin
Kanal13
1.58M subscribers
6-7-2023 12:01 a.m. EDT
https://www.youtube.com/watch?v=CuNuA3WaPn4

2. The Russians were expelled - Ukrainian army liberated new settlements in Bakhmut
Kanal13
1.58M subscribers
6-8-2023 1:00 a.m. EDT
https://www.youtube.com/watch?v=-ikUiwv7fNU


64 posted on 06/07/2023 10:00:58 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 61 | View Replies]

To: UMCRevMom@aol.com

All the people rooting for Ukraine here love it that biden and company are getting more wealthy continuing to rob taxpayers with money laundering operation in Ukraine.


65 posted on 06/07/2023 10:00:59 PM PDT by SACK UP
[ Post Reply | Private Reply | To 1 | View Replies]

To: UMCRevMom@aol.com

All the people rooting for Ukraine here love it that biden and company are getting more wealthy continuing to rob taxpayers with money laundering operation in Ukraine.


66 posted on 06/07/2023 10:01:00 PM PDT by SACK UP
[ Post Reply | Private Reply | To 1 | View Replies]

To: UMCRevMom@aol.com

All the people rooting for Ukraine here love it that biden and company are getting more wealthy continuing to rob taxpayers with money laundering operation in Ukraine.


67 posted on 06/07/2023 10:01:01 PM PDT by SACK UP
[ Post Reply | Private Reply | To 1 | View Replies]

To: SACK UP

Sorry.

Son’t know what comment to answer first! LOL
Appears you are stuttering!


68 posted on 06/07/2023 10:06:44 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 67 | View Replies]

To: UMCRevMom@aol.com

ARTICLE

‘They are destroying us.’ People plea to escape flooded Russian-occupied areas
Share

‘They are destroying us.’ People plea to escape flooded Russian-occupied areas
by Daria Shulzhenko and Igor Kossov
Kiev Independent
June 8, 2023 1:30 AM
https://kyivindependent.com/they-are-destroying-us-people-plea-to-escape-flooded-russian-occupied-areas/

Editor’s note: For this story, we spoke to people living or having family in the Russian-occupied areas of Ukraine. For their safety, they are identified by first name only.

After destroying the Nova Kakhovka dam and stranding thousands of Ukrainians in the catastrophic flood zone, Russians prevented people in occupied territories from fleeing or rescuing others, multiple accounts revealed on June 7.

About 80 settlements and 16,000 people were estimated to be in the critical areas. The lower eastern bank of the Dnipro, occupied by Russia, suffered the worst of the damage.

The town of Hola Prystan was 85% flooded by mid-afternoon and was expected to be completely flooded by the end of the day, with the water reaching 3.5 meters, according to the city’s military administration director Svitlana Linnik. There were 6,000 people in the city when the dam was blown up.

Oleshky, a city with a pre-invasion population of 24,000 people, is likely to be completely submerged as well. It’s expected to be days before the waters recede, letting people take stock of the damage. Many lost all their belongings, including their legal documents.

Social media is flooded with photos and videos of people sitting on rooftops as the water laps around them, with dwindling supplies and no way to escape. A woman pulling a small, frightened dog out of the murky floodwaters before trying to save what things she could. Occasional boats pass between the roofs and treetops that break through the surface.

The Kyiv Independent spoke with family members of people living under Russian occupation in Oleshky and collected accounts that residents posted on social media from the affected occupied areas.

They spoke of being trapped, either lacking the vehicles or fuel to escape or being blocked from leaving by the Russian occupying forces.

Russian news service TASS at 9:10 a.m. on June 7 claimed that 1,300 people were evacuated. Russia’s top collaborator in Kherson Oblast, Volodymyr Saldo, stated that people who endured material losses will get financial aid and that children are being transported to occupied Kherson Oblast and Crimea to “good holiday camps.”

But people in the area or their relatives said there was no evacuation to speak of whatsoever.

“Right now, many people are sitting on the roofs in Oleshky,” said Oleh – he has an aunt and a disabled nephew in the town. He described what they had been doing until their eventual rescue.

“They have neither food nor water. People helped to carry the son upstairs, and they did not take anything with them,” he said. “They’re sitting there waving some red rag. Boats are passing by, but no one has picked them up yet.”

A photograph published by a local Telegram channel shows people escaping the flooding on a rooftop in a Russian-occupied settlement in Kherson Oblast. (Nykolaevskyi Vanek/Telegram)

Serhiy, whose parents are trapped in Oleshky, shared a voice message from one of his acquaintances with the Kyiv Independent. This woman, who did not reveal her name, said the situation in the town is critical, with many children, elderly and disabled people stuck on their roofs for many hours.

She said Russian troops set up checkpoints in the less-flooded areas to “prevent” locals from escaping the disaster area or saving others, and she heard of people drowning.

“They are destroying (us),” she cried.

The water rose in a matter of hours, said Serhiy. Many people are sitting on the upper floors, while some residents are trying to rescue their loved ones.

The victims’ attempts to escape by boat or otherwise were thwarted by Russian forces, who wouldn’t let anyone leave if they didn’t have a Russian passport. Numerous people even reported being fired upon when they tried to escape the flooded areas.

Politico reported that Russian forces blocked people who tried to flee immediately after the dam’s destruction, forcing them to wait at home for an official list of evacuees that would be bussed out of the area.
What are the consequences of the Kakhovka dam’s demolition?

“The orcs abandoned the city,” said Yevhen Rischuk, Oleshky’s mayor in exile. “People are sitting on the roofs of houses. There are no boats in the city. The curfew is not canceled. Genocide.”

Worse, the Russians allegedly destroyed people’s means of escape. Serhiy’s parents told him the Russians went through the town and rounded up or destroyed all the boats they could find in the weeks before triggering the explosion that caused Ukraine’s most lurid catastrophe in decades.

“They stole the boats before all this... all the landings, they carried out all the boats,” said Serhiy, paraphrasing what his parents told him. “It’s like they were preparing for this to specially create a situation so that no one could escape.”

“We thought they were looting. Now I understand that there was a specific command to remove all means of flotation so that people couldn’t save themselves.”

Oleh said that his aunt told him a similar story.

“They (the boats) were taken away,” he said, quoting her. “People whose houses were locked kept their boats. The ones on the pier were smashed, shot up, or taken away.”

The occupation authorities themselves have vanished from Oleshky, Serhiy said. But civilians trying to flee were blocked from doing so.

“Yesterday, people tried to escape, so (the Russians) fired assault rifles in the air, and didn’t allow anyone to leave,” Oleh said.

Only people with Russian passports were being allowed to leave, multiple people confirmed.

Tetiana Akhtemenko, a resident of Antonivka, told Ukrainian TV that her family members spoke of a “very bad situation – the water keeps rising, but they’re forbidding evacuation, shooting at people’s legs. There were a few attempts to throw grenades” at people if they saw them attempting to escape.

Russians are also blocking volunteers from trying to help people, Ukrainian news site Texty reported, citing a woman whose residents are in the flood zone. The Russian forces have not explained to the locals the reason behind their actions. Even Russian volunteers, who arrived to help people from Crimea, were halted at the Russian checkpoints, according to Ukrainian volunteer Andriy Kniga, whose family members are in the disaster area.

With electrical outages and no mobile connections in affected towns, many people lost track of their trapped family members, many of whom are seniors or have mobility issues.

Telegram chats are filled with hundreds of people begging anyone available to rescue their loved ones, describing their situations as critical. Many of these pleas describe people sitting in attics and on rooftops in the villages of Kardashynka, Solontsy, and others. Volunteers ask people to geotag locations where trapped Ukrainians need evacuation.

One of them says that three families of seven people, with a dog and a parrot, are stuck on the rooftop somewhere in the village of Krynky with little food and drinking water.

“If only somebody could provide them with some supplies,” the message on one of the local Telegram chats reads.

Another message says that two women and a retiree who can not move without support are trying to save themselves by hiding on a rooftop of a two-storied building in Hola Prystan. Like many others, they are stuck there with little food and water.

“Please help to evacuate people. The water is coming, and the current is increasing,” the message reads.


69 posted on 06/07/2023 10:17:11 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 68 | View Replies]

To: crz

“I will alert my cousins in Jacksonville FL”

Absolutely!
Share that fire watching interactive map with all.
It is amazing! Includes U.S. states & Canada!
https://www.fireweatheravalanche.org/fire/state/michigan


70 posted on 06/07/2023 10:25:34 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 58 | View Replies]

To: crz

Actually, I was playing with the interactive map & found that it moves to other countries around the world as well!

Too cool!


71 posted on 06/07/2023 10:59:31 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 70 | View Replies]

To: UMCRevMom@aol.com

Not really sure what happened there.


72 posted on 06/07/2023 11:01:21 PM PDT by SACK UP
[ Post Reply | Private Reply | To 68 | View Replies]

To: Sunsong; ought-six; popdonnelly; PIF; rbmillerjr; ScottinVA

VIDEOS

1. Strong protests against Ukrainian war began in Russian parliament: MP made harsh speech about war
Kanal13
1.58M subscribers
6-7-2023 4:00 p.m. EDT
https://www.youtube.com/watch?v=oMU1UkP3GGo
*great!

2. Putin Was Forced to Retreat : Lukhasenko Ordered Not to Capture Russian Soldiers on the Border!
MES Global
312K subscribers
6-8-2023 1:30 a.m. EDT
https://www.youtube.com/watch?v=JmsZjLvRSHU


73 posted on 06/07/2023 11:10:43 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 71 | View Replies]

To: SACK UP

No problem.. it is getting late :)


74 posted on 06/07/2023 11:13:36 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 72 | View Replies]

To: AdmSmith; AmericanInTokyo; amnestynone; Apparatchik; AZJeep; babble-on; BeauBo; bert; ...

VIDEO WITH SUMMARIZED COMMENTARY:

07 Jun: MASTERFUL PLANNING! Ukrainians LEAVE RUSSIANS NO CHANCE TO WIN | War in Ukraine Explained
Reporting from Ukraine
277K subscribers
6-8-2023 EDT
https://www.youtube.com/watch?v=F_u_5Se0dCI

⚠️ Watch RFU in 18+ languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video I will tell you what happened on the four hundred and sixty seventh day of the war.

Day 469: Jun 07

The first attack was directed toward Lobkove. Ukrainians reportedly used at least two squads consisting of 4 armored fighting vehicles and 2 Humvees, which means that it was a light reconnaissance-in-force operation.

After a short engagement, Ukrainians understood the most current Russian positions and the number of troops defending them and withdrew with minor losses. Immediately after the attack, Ukrainian artillery shelled the region intensely in cooperation with drone operators, who corrected the fire to maximize the damage.

After a quick regrouping, Ukrainians assaulted Russians in Lobkove again. One assault unit advanced from Stepove and attacked Russians from the hills. If we look at the topographic map, we can see that Lobkove is located in the lowlands, which means that Ukrainians had a tactical advantage. However, Russians in Zherebianky are also at elevated positions and could with ease fire at Ukrainians.

That is why the second Ukrainian group advanced along the gully and assaulted Zherebianky, drawing their attention away from the main target. Russian sources reported that they stopped Ukrainians 1 km away from Zherebianky, which means that Ukrainians never left the gully and confirms that they were just distracting the enemy. Russian sources reported that Ukrainians also used 2 tanks to provide fire support from a distance and help to take Lobkove as fast as possible.

As a result, Ukrainians destroyed Russians in Lobkove and penetrated Russian positions by 2 km. Some Russian sources reported that Ukrainians immediately abandoned Lobkove, and the village became a grey zone, but just like the last time, these reports were based on the fact that Ukrainians withdrew heavy equipment away from the contact line after a successful assault.

Lastly, when it comes to the previous successful Ukrainian attack on Novodonetske, the area of Ukrainian control has shank due to the Russian counterattacks. Nonetheless, Russian sources confirm here as well that Ukrainians retained a foothold south of the river, which is located on the tactical heights west of the settlement.

We can observe that the Head of the Wagner forces, Prigozhin, was likely right when he criticized the obsession of the Russian High Command with settlements. He said that regular Russian forces often prioritize holding or capturing settlements over tactical positions around these settlements, which basically means choosing the path of the most resistance.

Prigozhin said that this produces good-looking reports instead of good situations on the ground. Prigozhin also ridiculed the most recent Russian situational report, where Defense Minister Shoigu reported that they destroyed 8 Leopards during the fights around Novodonetske. Russian Ministry of Defense decided to back up its claims and solidify its reputation and posted combat footage of how its assault helicopter Ka-52 destroyed 4 Leopards just 3 km north of Novodonetske. Unfortunately for the Russian Ministry of Defense, people quickly identified from the silhouette that all of the targets were combine harvester.

Fortunately, there were no casualties as the farmers were not working at the time. Today real combat footage was finally released, and it confirms that Ukrainians mostly used T-64 tanks. So far, the strategic reserves, namely the 9th and 10th Corps, that Ukrainians created specifically to participate in the main phase of the counteroffensive remain untouched, and Leopard tanks have not been used as well.

Just like during the previous counteroffensive operations, Ukrainians are increasing the intensity of attacks along the whole front line slowly, and only when they reach the main line of fortification and can no longer advance by conducting small attacks Ukrainians will pick the weakest spot and finally use their Leopards to deliver the main blow.

*** Select the 3 horizontal dots to view the Complete Transcript [Below video/ top right corner]


75 posted on 06/07/2023 11:20:49 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 24 | View Replies]

To: UMCRevMom@aol.com
Youtube, Ukraine Matters:

"Ru sources claim a massive tank led assault is underway in the Orikhiv area towards Tokmak.
The assault began late at night.
Details later"

My speculation:

Tokmak is on the route to Melitopol. Taking Melitopol would divide the Zaporizhia Oblast along its narrowest axis. The distance between the Dnipro River and the Molochnyi Estuary is 50 miles/80 km. Russia would lose a direct land connection to Western Zaporizhia, Southern Kherson and Crimea except over the Kerch Bridge. Together with the destruction of the Nova Kakhovka dam cutting off fresh water to Crimea, holding these areas becomes impossible.

Assuming the US and NATO knew in advance, should Ukraine achieve this goal, then they will show they can deliver on what was promised and continue getting aid. It will also show Russia is incompetent militarily and politically, weakening their international standing even more.

Like Kherson and Kharkiv, during the first few days there is the Ukrainian news blackout and Russian disinformation making what is happening unclear. Given the importance of what is happening, it make take several more days for even a small amount of clarity to happen.

76 posted on 06/08/2023 12:07:06 AM PDT by Widget Jr (🇺🇦 Слава Україні! 🇺🇦 Sláva Ukrayíni! 🇺🇦 ☭ No CCCP 2.0 ☭)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Widget Jr

“Maybe we should take a closer look at Kyiv Hydroelectric power plant? There’s a beautiful water reservoir there.”
“What will we achieve?”
“Nothing. Just show them”

Russian propagandists suggest also destroying Kyiv HPP dam to flood Kyiv residents, too.

https://twitter.com/Gerashchenko_en/status/1666767540742225924
video Eng sub


77 posted on 06/08/2023 4:31:37 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 76 | View Replies]

To: AdmSmith
Check out these photos showing newly updated water pipes in a psychiatric clinic in St. Petersburg, Russia.

Looks like the insane are running the asylum and are in charge of hiring the plumbers. Makes sense. It's Russia… Why would an insane asylum be any different than the rest of the country? 🤷‍♀️

https://twitter.com/NatalkaKyiv/status/1666997596664000513

78 posted on 06/09/2023 12:04:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 77 | View Replies]

To: AdmSmith
Reporting from Ukraine 08 Jun: NEW GAINS SECURED. Ukrainians Storm the 1st Line of Defense

Day 470:

Today the most intense clashes took place in the Orikhiv direction. First of all, more information became available about the results of yesterday's attacks. When it comes to Lobkove, if yesterday Russian sources claimed that this village is in the grey zone, then today Russian sources confirmed that Ukrainians had established total control over the settlement and started moving further. It was reported that in order to capitalize on these tactical gains, the size of the assault group has doubled: yesterday, Ukrainians used 4 Humvees and 2 tanks, while today, Ukrainians reportedly had 8 Humvees and 4 tanks.

https://www.youtube.com/watch?v=Ac-WQbqV5DI
5 min video

79 posted on 06/09/2023 12:10:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 78 | View Replies]

To: AdmSmith

Brilliant!! Its so much easier to find and fix leaks if you don’t hide the pipes in the walls.


80 posted on 06/09/2023 12:23:12 AM PDT by Nachoman (Proudly oppressing people of color since 1957.)
[ Post Reply | Private Reply | To 78 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson