Well, if he was indeed heading for Kuala Lumpur to claim his father's body, there is no way the local authorities let media chase him. Either he has not come or he was on a different flight, landing on a different airport, and whisked away by local authorities to a secure location.
No sign of Kim Jong-nam's son at KLIA2
To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; endthematrix; ...
2 posted on
02/20/2017 7:51:52 AM PST by
TigerLikesRooster
(dead parakeet + lost fishing gear = freep all day)
To: TigerLikesRooster
3 posted on
02/20/2017 7:53:32 AM PST by
ClearCase_guy
(Abortion is what slavery was: immoral but not illegal. Not yet.)
To: TigerLikesRooster
4 posted on
02/20/2017 7:56:02 AM PST by
dfwgator
To: TigerLikesRooster
Release the Body to the People who Murdered him.
Sure, why not.
14 posted on
02/20/2017 9:35:57 AM PST by
Kickass Conservative
(The way Liberals carry on about Deportation, you would think "Mexico" was Spanish for "Auschwitz".)
To: TigerLikesRooster
The DNA can be sent in a test tube.
16 posted on
02/20/2017 9:44:44 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson
