Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

N. Korea: Jong-nam’s son Han-sol arriving in KL
The Star ^ | 20 February 2017 | AKIL YUNUS

Posted on 02/20/2017 7:51:13 AM PST by TigerLikesRooster

Jong-nam’s son Han-sol arriving in KL

By AKIL YUNUS 20 February 2017

PETALING JAYA: Members of the media from local and international organisations are rushing to Kuala Lumpur International Airport 2 (KLIA2) following a tip-off that the son of Kim Jong-nam is arriving in Malaysia Monday evening.

The international press, including Korean, Japanese, and Chinese news outlets, earlier received a message saying that Kim Han-sol, 21, is due to land at KLIA2 on an AirAsia flight tonight.

“Dear press members, (this is) to inform that the son of Kim Jong-nam will be arriving at KLIA2 today on an AirAsia flight. Expected to arrive at 7.50pm,” said the message that was making the rounds this evening.

It has since been confirmed that Han-sol is flying from Macau on flight AK8321, arriving at 7.40pm.

It is not known if he will be meeting anyone upon arrival.

Jong-nam, the half-brother of North Korean leader Kim Jong-un, was murdered at KLIA2 a week ago when two women sprayed his face with a chemical as he was about to check into a flight to Macau.

His family had been unreachable since the incident.

Malaysia has refused to hand over the body to North Korea, saying it can only be released to the next-of-kin.

(Excerpt) Read more at thestar.com.my ...


TOPICS: Foreign Affairs; News/Current Events
KEYWORDS: 201702; assassination; kimhansol; kimjongnam; korea; kualalumpur; malaysia; nkorea; northkorea
Well, if he was indeed heading for Kuala Lumpur to claim his father's body, there is no way the local authorities let media chase him. Either he has not come or he was on a different flight, landing on a different airport, and whisked away by local authorities to a secure location.

No sign of Kim Jong-nam's son at KLIA2

1 posted on 02/20/2017 7:51:13 AM PST by TigerLikesRooster
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; endthematrix; ...

P!


2 posted on 02/20/2017 7:51:52 AM PST by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

3 posted on 02/20/2017 7:53:32 AM PST by ClearCase_guy (Abortion is what slavery was: immoral but not illegal. Not yet.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

4 posted on 02/20/2017 7:56:02 AM PST by dfwgator
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

“Palace revolution” - Communist royalty fighting over the right to the throne.

A Game of Thrones worthy of Mary, Queen of Scots. Bonnie Prince Charlie, grandson of Mary, comes riding up....

Well, look up the history yourself.


5 posted on 02/20/2017 7:58:58 AM PST by alloysteel (John Galt has chosen to take the job. This time, Atlas did NOT shrug.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: dfwgator

Look, Ma!
No Hans!....................


6 posted on 02/20/2017 7:59:19 AM PST by Red Badger (If "Majority Rule" was so important in South Africa, why isn't it that way here?.......)
[ Post Reply | Private Reply | To 4 | View Replies]

To: alloysteel
This is all unfolding in a neighborhood where three largest economies and three largest nuclear powers are facing one another.
7 posted on 02/20/2017 8:08:54 AM PST by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 5 | View Replies]

To: TigerLikesRooster

——in a neighborhood where three largest economies and three largest nuclear powers are facing one another. -—

Very perceptive thought.

In a world here that is Americentric, that thought requires more thought to develop full understanding.


8 posted on 02/20/2017 8:13:10 AM PST by bert (K.E.; N.P.; GOPc;WASP .... Macroagression melts snowflakes)
[ Post Reply | Private Reply | To 7 | View Replies]

To: ClearCase_guy; Cap Huff

U cant make this stuff up.


9 posted on 02/20/2017 8:17:13 AM PST by Dog (..."I'm just a cook....")
[ Post Reply | Private Reply | To 3 | View Replies]

To: Dog

“....Jong-nam style!.....Jong-nam style!.....Jong-nam style!..”


10 posted on 02/20/2017 9:12:40 AM PST by elcid1970 ("The Second Amendment is more important than Islam. Buy ammo.")
[ Post Reply | Private Reply | To 9 | View Replies]

To: elcid1970

11 posted on 02/20/2017 9:14:51 AM PST by dfwgator
[ Post Reply | Private Reply | To 10 | View Replies]

To: dfwgator

News writers dream of a headline like that.


12 posted on 02/20/2017 9:24:00 AM PST by Rebelbase
[ Post Reply | Private Reply | To 4 | View Replies]

To: Rebelbase

But this is the ultimate headline, and yes it was a real headline until ESPN changed it to “Gamecocks”.

“Nutt to replace Johnson with Dick to take on Cocks.”


13 posted on 02/20/2017 9:31:41 AM PST by dfwgator
[ Post Reply | Private Reply | To 12 | View Replies]

To: TigerLikesRooster

Release the Body to the People who Murdered him.

Sure, why not.


14 posted on 02/20/2017 9:35:57 AM PST by Kickass Conservative (The way Liberals carry on about Deportation, you would think "Mexico" was Spanish for "Auschwitz".)
[ Post Reply | Private Reply | To 1 | View Replies]

To: dfwgator

LOL! Though I prefer depicting cannibalism in the little riceball’s appetite:

“unsuccessful Nork general pot roast (medals removed). Garnished with bundt cake hat & gold shoulder boards”


15 posted on 02/20/2017 9:39:18 AM PST by elcid1970 ("The Second Amendment is more important than Islam. Buy ammo.")
[ Post Reply | Private Reply | To 11 | View Replies]

To: TigerLikesRooster

The DNA can be sent in a test tube.


16 posted on 02/20/2017 9:44:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: dfwgator

if the title is genuine then that’s too funny. if it was changed to be funny well then not as funny!


17 posted on 02/20/2017 9:44:54 AM PST by sit-rep
[ Post Reply | Private Reply | To 4 | View Replies]

To: dfwgator

That is a very testosterone filled headline!


18 posted on 02/20/2017 9:47:51 AM PST by Yaelle
[ Post Reply | Private Reply | To 13 | View Replies]

To: ClearCase_guy

Lol!


19 posted on 02/20/2017 9:16:05 PM PST by rdl6989
[ Post Reply | Private Reply | To 3 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson