Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: gleeaikin; 2ndDivisionVet; PIF; Jimmy Valentine; SunkenCiv; a_Turk; TigerLikesRooster; ETL

Hitler invaded Poland in SEP 1939 when he realized Germany’s financial mess was only getting worse, with or w/o war.

The Russian economy is in Deep S-t:

A former deputy chairman of the Russian Central Bank has said Russia’s economic crisis is worse than Moscow admits and that the Kremlin’s optimism about future prospects “has not been based on reality.

Aleksashenko said the real problems facing Russia’s economy are a lack of investment, high inflation, and the declining ruble, which has lost half of its value against the U.S. dollar since early 2014.

Further, he said, the bulk of Russian exports - as much as 80 percent - consists of raw materials and commodities.

But the economic slowdown in China has eased the global demand for such products.
http://www.rferl.org/content/damn-lies-deep-crisis-russia-central-banker-economy/27550209.html

http://www.xe.com/en/currencycharts/?from=USD&to=RUB&view=12h

Turkish foreign minister claims ground force could be sent into Syria - with Saudi Arabia’s assistance - to fight Islamic State. His comments come after Bashar al-Assad defiantly said he would recapture the whole of Syria and keep “fighting terrorism”.

http://www.scmp.com/news/world/article/1912753/turkish-foreign-minister-claims-ground-force-could-be-sent-syria-saudi

German gov’t source: Bundestag cyberattack “clearly the work of a Russian military intelligence agency”
http://www.spiegel.de/netzwelt/netzpolitik/deutscher-bundestag-russischer-geheimdienst-unter-hacker-verdacht-a-1074641.html

“The German quote approved by the Kremlin contained the term ‘einen neuen Weltkrieg,’ or a new world war,”
http://www.rferl.org/content/world-war-medvedev-translation-tempest-handelsblatt/27549372.html

This is not new, the writing has been on the wall for a long time. This article is from 2014:
http://www.politico.com/magazine/story/2014/03/new-cold-war-russia-104954

Putin knows he has a window till 20 JAN 2017 to break NATO, so he’s playing high-stakes poker. He could cause #WW3.
http://observer.com/2016/02/mounting-evidence-putin-will-ignite-wwiii/


38 posted on 02/13/2016 6:16:16 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies ]


To: AdmSmith
But, it is still time to reverse and prevent Putin from saying все идет по планy
39 posted on 02/13/2016 6:21:47 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 38 | View Replies ]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; cardinal4; ColdOne; ...

Thanks AdmSmith.

http://www.freerepublic.com/focus/news/3396020/posts?page=38#38


44 posted on 02/13/2016 10:30:08 AM PST by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 38 | View Replies ]

To: AdmSmith

Will the proposed privatization solve anything?

Russian oligarchs are the most likely potential buyers of the stakes in some of the country’s largest companies that President Vladimir Putin wants to sell.
http://www.reuters.com/article/us-russia-privatisation-plan-idUSKCN0VB23D

Who dares to purchase assets in Russia? The risk premium is extreme, just ask BP (with a 20 % interest in Rosneft). http://www.theguardian.com/business/2016/feb/02/bp-annual-loss-biggest-for-20-years-axes-thousands-of-jobs-deepwater


49 posted on 02/14/2016 8:44:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 38 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson