Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russia warns of 'new world war' starting in Syria
The Telegraph ^ | 11 Feb 2016 | Richard Spencer

Posted on 02/11/2016 7:24:36 PM PST by E. Pluribus Unum

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-58 last
To: ETL

What next?
http://www.independent.co.uk/news/world/middle-east/saudi-arabia-sends-troops-and-fighter-jets-to-military-base-in-turkey-ahead-of-intervention-against-a6871611.html


41 posted on 02/13/2016 7:04:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 40 | View Replies]

To: AdmSmith

The fact is that Putin’s Russia and the EU are engaged in a race against time: the question is which one will collapse first.

The Putin regime faces bankruptcy in 2017, when a large part of its foreign debt matures, and political turmoil may erupt sooner than that. The president’s popularity, which remains high, rests on a social compact requiring the government to deliver financial stability and a slowly but steadily rising standard of living. Western sanctions, coupled with the sharp decline in the price of oil, will force the regime to fail on both counts.

The most effective way Putin’s regime can avoid collapse is by causing the EU to collapse sooner. An EU that is coming apart at the seams will not be able to maintain the sanctions it imposed on Russia following its incursion into Ukraine. On the contrary, Putin will be able to gain considerable economic benefits from dividing Europe and exploiting the connections with commercial interests and anti-European parties that he has carefully cultivated.
http://www.theguardian.com/commentisfree/2016/feb/11/putin-threat-europe-islamic-state


42 posted on 02/13/2016 7:21:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 41 | View Replies]

To: AdmSmith

20 Saudi F-15 in Turkey, how will they be used?


43 posted on 02/13/2016 8:26:47 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 42 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; cardinal4; ColdOne; ...

Thanks AdmSmith.

http://www.freerepublic.com/focus/news/3396020/posts?page=38#38


44 posted on 02/13/2016 10:30:08 AM PST by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 38 | View Replies]

To: SunkenCiv

Putin’s views are indeed global. He sees America as the “sick man of the World”. He believes that the moment is ripe to bring Mother Russia back to its previous “glory”. He sees that Russia ought to get back its status as a global decider through regaining control of its periphery. East Europe will have its turn.

If Putin is not stopped in Syria, as he was not stopped in Ukraine, he will end up reducing Western influence in the region to almost non-existence. Putin’s favorite game is to turn his adversaries’ move to his favor. His point of start is always his adversaries’ moves. He plans his steps based on this frame of mind.

http://mebriefing.com/?p=2160


45 posted on 02/13/2016 12:15:14 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 44 | View Replies]

To: SunkenCiv

Russia needs its hand slapped, hard.

Russia has crap all for a deployable military. The only reason Russia has any juice at all these days is because we’re still besieged on the domestic front by Cold War wonks who were indoctrinated into utter and complete horror at the mere mention of the Great Soviet Bear.


46 posted on 02/13/2016 12:25:53 PM PST by Grimmy (equivocation is but the first step along the road to capitulation)
[ Post Reply | Private Reply | To 44 | View Replies]

To: Grimmy

Yes, and by the many leftists who support the resurgent dictatorship.


47 posted on 02/13/2016 12:35:25 PM PST by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 46 | View Replies]

To: Grimmy

It has started: Turkish military also hit targets of regime in northwest Syria: state media

https://twitter.com/AFP/status/698600206997327872


48 posted on 02/13/2016 12:45:10 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 46 | View Replies]

To: AdmSmith

Will the proposed privatization solve anything?

Russian oligarchs are the most likely potential buyers of the stakes in some of the country’s largest companies that President Vladimir Putin wants to sell.
http://www.reuters.com/article/us-russia-privatisation-plan-idUSKCN0VB23D

Who dares to purchase assets in Russia? The risk premium is extreme, just ask BP (with a 20 % interest in Rosneft). http://www.theguardian.com/business/2016/feb/02/bp-annual-loss-biggest-for-20-years-axes-thousands-of-jobs-deepwater


49 posted on 02/14/2016 8:44:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 38 | View Replies]

To: Zhang Fei; thackney
Rosneft’s management has agreed with all the decisions of the Government on the company's privatization, however, the effective privatization is possible at the oil price of $100, the head of Rosneft, I. Sechin, said.

If to think at the expert's level, it is very simple - we need to wait until the oil price is $100.

http://rusmininfo.com/news/10-02-2016/sechin-rosneft-agrees-privatization-oil-price-better-be-100?utm_source=dlvr.it&utm_medium=twitter

Take a look at the oil futures market http://futures.tradingcharts.com/marketquotes/CL_.html

A big conflict will give higher price. The question is if the Russians will purchase a lot of call options, is that insider trading?

50 posted on 02/14/2016 9:01:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 49 | View Replies]

To: AdmSmith

Video from Northern Thunder in N Saudi; a lot of Kuwaiti M-84s https://www.youtube.com/watch?v=kZKSRdFQ8F4


51 posted on 02/14/2016 11:03:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 35 | View Replies]

To: SunkenCiv

Will they stop at the Saudi-Iraqi border?


52 posted on 02/14/2016 11:08:20 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 51 | View Replies]

To: AdmSmith
They'll be stopped by the body bags.

53 posted on 02/14/2016 11:30:15 AM PST by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 52 | View Replies]

To: SunkenCiv
At least one casualty initially it was 21 countries http://www.freerepublic.com/focus/news/3396020/posts?page=35#35 now it is 20.
http://www.arabnews.com/news/880491

Who is missing the party?

54 posted on 02/14/2016 11:38:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 53 | View Replies]

To: AdmSmith

... and now 19 http://www.business-standard.com/article/news-ians/saudi-arabia-announces-major-military-manoeuvres-with-19-allies-116021500021_1.html


55 posted on 02/14/2016 11:40:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 54 | View Replies]

To: AdmSmith

64 civilians were killed across #Syria on Saturday
95% of them by #Putin and #Assad
https://twitter.com/JulianRoepcke/status/698988208995102720


56 posted on 02/14/2016 2:18:28 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 55 | View Replies]

To: ETL

Russia has to reform its economy otherwise there will be 15 years of stagnation according to the Ministry of Finance.
http://www.vedomosti.ru/economics/articles/2016/02/15/629411-15-let-zastoya (In Russian)

Interesting to read the comments, they have Kremlin Trolls there as well ;-)


57 posted on 02/15/2016 1:44:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 56 | View Replies]

To: a_Turk

Erdogan closed Zaman, but the article is here http://web.archive.org/web/20160225055933/http://www.todayszaman.com/national_sources-say-ex-president-gul-has-no-immediate-plans-to-form-new-party_412160.html

More info about the opposition to Erdogan http://www.turkeyanalyst.org/publications/turkey-analyst-articles/item/516-the-sound-of-footsteps-erdogan%E2%80%99s-new-enemies-within.html Any more info?


58 posted on 03/11/2016 2:20:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-58 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson