Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

In Rare Interview, ISIS Terrorist Gives 5 Bone-Chilling Claims Of What the Group Is Planning Next
IJ Review ^ | Sep 26, 2014 | Justen Charters

Posted on 09/27/2014 9:59:42 AM PDT by Former Proud Canadian

In an exclusive interview with Vice News, an ISIS terrorist from Canada revealed the Islamic State’s chilling agenda and said they will only stop when the “leaders of the infidels are beheaded.”

The terrorist being interviewed is Farah Shirdon, and is known for his presence in an ISIS propaganda video in which he says, “We are going for you, Barack Obama.”

(Excerpt) Read more at ijreview.com ...


TOPICS: Foreign Affairs; Syria
KEYWORDS: is; isil; isis; isisterrorthreat; jvteam; terrorthreat
Navigation: use the links below to view more comments.
first previous 1-2021-4041-58 last
To: vladimir998

bump


41 posted on 09/27/2014 11:43:01 AM PDT by VRW Conspirator (The next DNC convention will be spoken in Spanish; Press 1 for English)
[ Post Reply | Private Reply | To 19 | View Replies]

To: Dqban22

Those two pictures say it all. It is a religious war. And that death is the only answer to these monsters.


42 posted on 09/27/2014 11:45:29 AM PDT by VRW Conspirator (The next DNC convention will be spoken in Spanish; Press 1 for English)
[ Post Reply | Private Reply | To 30 | View Replies]

>> 5 Bone-Chilling Claims

#6 Persuade US Administration to remain passive allowing ISIS to organize into a sustainable nemesis.

Err... nevermind, that already happened.


43 posted on 09/27/2014 11:52:57 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VRW Conspirator

>> It is a religious war

Islam is a war plan. It’s not about Faith.


44 posted on 09/27/2014 11:54:07 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 42 | View Replies]

To: Mariner

“Not so, as said before Turkey and/or the Saudis could also eliminate this threat the the emotional well-being of the west:)” — before i go, you’re correct, they could. The caveat, ones you mention would need incentive to do so. The wellbeing of the west isn’t one incentive. Keeping AQ et al running are in their best interest.


45 posted on 09/27/2014 12:04:09 PM PDT by odds
[ Post Reply | Private Reply | To 40 | View Replies]

To: gandalftb
ISIS has made a major tactical blunder because its leadership does not see a larger picture and feels immune from attack.

I think they're true believers. They're not just using religion as a cover for temporal ambitions. And you kind of have to be a true believer to mount any kind of war effort against the combined might of the infidel powers. In Muhammad's time, the technological gap between his tribesmen and the Byzantines to the West and Sassanids to the East was bridgeable via the capture or the hiring of artisans to build siege engines. Today's gap is far too large. You can't hire designers to build F-15's, petroleum refineries and cutting edge anti-aircraft missile batteries. The lead time is too long, and the human talent and the resources necessary out of their league, and even the financial league of the gulf state treasuries combined, unless they erase their lavish cradle-to-grave welfare systems.

46 posted on 09/27/2014 12:12:55 PM PDT by Zhang Fei (Let us pray that peace be now restored to the world and that God will preserve it always.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: SamAdams76

Is it talk—or can ISIS deliver on their boasts? If they can—they will do better than Osama Ben Laden—who was always threatening and only a few times really geting an attack underway. So far they have been as good as their word-—but an ex-con cutting off one head—doesn’t make an attack.—BUT if they do it—we should declare war upon them and start cleaning house.
1. Kick the Democrat-Progressives out of all political offices by the balot box or impeach them. They did this to us.
2. Start to gear the nation for war—bring back the Draft—for 18 to 21 year old men and woman.
3. Put in Tarrifs on foreign made goods we need—we can depend on China or India.
4. Put in rationing of stragetic goods like Oil—You get one tank a week.
5. Restore the weak and threatened grid.
6. Monitor the Internet—if you have an ISIS Supporting page—you go to the Labor Camps!
7. Monitor all Mosques—them that preach anti-American hate—closed and burned. This goes for Churches Too—get that Rev. Wright.
8. The border locked down tight. No drugs, no illegals, no people, no goods! Mine the border, machine guns, motes, fences, Make it better than the Berlin Wall.
9. Close all traffic with Mexico—Any who protest—send them back south.
10. PC, MuliCulturalism Banned. All on welfare—drafted into the American reseve forces to sweep the streets and work for their money.
11. Start an American Foreign legion—if you want to be a citizen—you got to fight our enemies!
12. Bring back the pledge of alegence for all spoting events, classes meeting, courtroom activites—TV shows etc...


47 posted on 09/27/2014 12:32:40 PM PDT by Forward the Light Brigade (Into the Jaws of H*ll Onward! Ride to the sound of the guns!)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Former Proud Canadian
The terrorist being interviewed is Farah Shirdon, and is known for his presence in an ISIS propaganda video in which he says, “We are going for you, Barack Obama.”

That sounds kinda racist. He should be ashamed at his inappropriate behavior.

48 posted on 09/27/2014 12:36:39 PM PDT by dennisw (The first principle is to find out who you are then you can achieve anything -- Buddhist monk)
[ Post Reply | Private Reply | To 1 | View Replies]

To: MeshugeMikey
we are going....for you...Barack Obama...almost sounds as though they are going to conduct thier beheading jihads FOR The Great Leader

Agree. Either way, bring it on. Enoug of this pussy footing around. It's long past time we put a stop to this. No more 9/11. No more Boston bombing. No more beheading. No more of it, period.

49 posted on 09/27/2014 1:31:00 PM PDT by bgill
[ Post Reply | Private Reply | To 7 | View Replies]

To: Former Proud Canadian

These guys are becoming comparable to the bogyman.


50 posted on 09/27/2014 1:31:45 PM PDT by Mike Darancette (The first stage of cultural death is denial.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tet68
New York will continue to be a prime terror target. The countermeasure is simple. Kill the terrorists before they can mount another attack.

Kill them. Kill their families, their children. Kill their bankers, their grocers, their plumbers, their doctors and lawyers. Kill their friends. Kill their friend's families. Kill them before they can kill you.

51 posted on 09/27/2014 1:38:38 PM PDT by Former Proud Canadian (Drink your Ovaltine)
[ Post Reply | Private Reply | To 39 | View Replies]

To: ballplayer

Ideally, that is the only way to ensure our own domestic safety.

But one black muslim throws the race card down, it will all screech to a halt.


52 posted on 09/27/2014 2:02:21 PM PDT by Molon Labbie (Prep. Now. Live Healthy, take your Shooting Iron daily.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Flick Lives
What good is the NSA and CIA if they let a group like this come to fruition?

THANK YOU!!!! Why isn't anyone asking this question? Isn't this why they are sticking their hands down YOUR pants at the airport?

I say dismantle every piece of the post 9/11 BS because it's been a colossal failure. Or none of this is real, has never been real and it's all designed, allowed and used by proxy for other nefarious purposes.

53 posted on 09/27/2014 2:08:39 PM PDT by riri (Plannedopolis-look it up. It's how the elites plan for US to live.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Former Proud Canadian

If, by some outrageous miracle, ISIS gets their hands on Obama to behead him, the idiot would still claim Islam is for peace.


54 posted on 09/27/2014 2:11:54 PM PDT by CodeToad (Islam should be outlawed and treated as a criminal enterprise!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gandalftb
ISIS is not a threat to the West, not now. They will be training on how to duck and run for cover for some time.

Agree, they are a threat to the locals. Saudi is not amused as ISIS is following almost exactly the same blueprint, including beheading, that Ibn Saud used in the 20s to grab what is now Saudi Arabia.

The ultimate goal of ISIS and other similar groups is to take over Mecca and Medina and replace the Saudi king, i.e. to be the new “Custodian of the Two Holy Mosques”. The fact that the original sites were destroyed many years ago is not of importance to them. They are fighting for a fiction that is imprinted in their brains. No wonder that they are against the West as science and technology not to mention democracy is considered anathema.

55 posted on 09/27/2014 3:11:55 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Former Proud Canadian

Beheaded by his own islamic brethren. Even within the White House. Hope it doesn’t happen for the sake of the Secret Service. But it doesn’t seem outside the realm of possibility.


56 posted on 09/27/2014 3:49:30 PM PDT by onedoug
[ Post Reply | Private Reply | To 1 | View Replies]

To: SamAdams76

“So you are saying the United States engages in terrorism as well?”

The US (used to) terrorize its enemies into submission. Now, not so much. It is about “understanding” eagerness to “listen”, which translates into “Weakness” in international politics.


57 posted on 09/27/2014 4:33:52 PM PDT by sagar
[ Post Reply | Private Reply | To 25 | View Replies]

To: AdmSmith

Good points. ISIL has been very clear that their ultimate goal is the conquest of Mecca.


58 posted on 09/28/2014 12:55:15 PM PDT by gandalftb (Go Seahawks!)
[ Post Reply | Private Reply | To 55 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-58 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson