Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Ukrainian attack on Crimean port damages Russian warship, Moscow says
NY Post ^

Posted on 12/26/2023 10:03:16 AM PST by Eleutheria5

A Ukrainian attack on the Crimean port of Feodosia damaged a large Russian landing ship and killed one person, Moscow said on Tuesday after Kyiv said it had destroyed an important Russian warship.

The Russian defense ministry was cited by the Interfax news agency as saying that Ukraine had used air-launched missiles to attack Feodosia and that the ‘Novocherkassk’ large landing ship had been damaged in the raid.

The ‘Novocherkassk,’ which was built in Poland and entered service in the late 1980s, is designed for amphibious landings and can carry various types of armored vehicles, including tanks.

Footage posted on several Russian news outlets on the Telegram messaging app, purportedly from the port, showed powerful explosions detonating and fires burning.

Sergei Aksyonov, the Russian-installed governor of Crimea, said on the Telegram messaging app that one person had been killed, two injured and six people evacuated from their homes.

Although a Ukrainian counteroffensive has made little in the way of battlefield gains and the Russian military has regained the initiative in several places, Ukraine has been able to launch a series of attacks on Crimea, the headquarters of Russia’s Black Sea Fleet, inflicting serious damage.

The Ukrainian air force said its pilots had attacked Feodosia at about 2:30 a.m. local time with cruise missiles, destroying the ‘Novocherkassk.’

“And the fleet in Russia is getting smaller and smaller! Thanks to the Air Force pilots and everyone involved for the filigree work!” the commander of Ukraine’s air force, Mykola Oleshchuk, said on Telegram.

.....

(Excerpt) Read more at nypost.com ...


TOPICS: News/Current Events; Russia; Ukraine; War
KEYWORDS: aksyonov; crimea; feodosia; novocherkassk; ukraine
Navigation: use the links below to view more comments.
first previous 1-2021-4041-44 next last
To: DUMBGRUNT; kagan

Some of his compulsive spamming is false and some of it is true, he doesn’t care one way or the other, he can’t control his compulsions.


21 posted on 12/26/2023 11:33:01 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 19 | View Replies]

To: DUMBGRUNT

Pot. Kettle.

“The influencers behind the Ukrainian PR machine
Lobbyists, lawyers and public relations pros have blitzed Capitol Hill and the media to push Ukraine aid.”

https://www.politico.com/news/2022/03/17/influencers-ukrainian-pr-machine-00018299

Propaganda on all sides. And there are at least five other threads on FR now about this same incident. Ahem.


22 posted on 12/26/2023 11:43:26 AM PST by CatHerd (Whoever said "All's fair in love and war" probably never participated in either.)
[ Post Reply | Private Reply | To 20 | View Replies]

To: ansel12

Yes.


23 posted on 12/26/2023 11:43:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies]

To: MeganC
It's just a little damage. Some bondo, some primer, and a little elbow grease and it'll be good as new!

or ...It's just a flesh wound..

https://www.youtube.com/watch?v=UijhbHvxWrA

24 posted on 12/26/2023 11:45:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

Ha!


25 posted on 12/26/2023 11:54:01 AM PST by MeganC (There is nothing feminine about feminism. )
[ Post Reply | Private Reply | To 24 | View Replies]

To: marcusmaximus

But, but, but. But Moscow claimed only one person was killed in the attack!


26 posted on 12/26/2023 12:11:40 PM PST by Uncle Lonny
[ Post Reply | Private Reply | To 13 | View Replies]

To: Kazan

Why is Russia busy demolishing tiny villages in Ukraine? The Russians get thousands of their men killed in order to capture the rubble of what was a tiny farming village.


27 posted on 12/26/2023 12:11:46 PM PST by freeandfreezing
[ Post Reply | Private Reply | To 7 | View Replies]

To: Eleutheria5

Destroyed as can be seen in the pictures.


28 posted on 12/26/2023 12:12:08 PM PST by freeandfreezing
[ Post Reply | Private Reply | To 1 | View Replies]

To: Uncle Lonny

Now reports of up to 87 dead on that ship.


29 posted on 12/26/2023 12:14:43 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 26 | View Replies]

To: CatHerd
OSCE reports don't support your claim.

Before Russia's 2022 invasion only a few civilians per year were injured or killed in Ukraine from actual fighting or shelling. And many of them were Ukrainians hit by shelling from Donetsk. Most were victims of unexploded ordnance.

But thanks for showing us you are just another Russian propagandist.

30 posted on 12/26/2023 12:15:17 PM PST by freeandfreezing
[ Post Reply | Private Reply | To 17 | View Replies]

To: CatHerd
Admit it. The ship got destroyed. And it had something very explosive on it.

Now we can watch the FR's pro-Russian propaganda team do their best to cover up the loss.

31 posted on 12/26/2023 12:16:34 PM PST by freeandfreezing
[ Post Reply | Private Reply | To 22 | View Replies]

To: for-q-clinton

Russia doesn’t scruple invading Ukraine.


32 posted on 12/26/2023 12:50:12 PM PST by Eleutheria5 (Every Goliath has his David. Child in need of a CGM system. https://gofund.me/6452dbf1. )
[ Post Reply | Private Reply | To 18 | View Replies]

To: MeganC; All

Scattered throughout Feodosia are not only pieces of iron from the exploding Novocherkassk, but also pieces and scraps of bodies. Protruding bones, remains of skulls, shreds of meat.


33 posted on 12/26/2023 12:54:00 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 25 | View Replies]

To: freeandfreezing

Yes, OSCE reports do support my claim.


Key figures

Casualties by year

• 486 in 2017; 238 in 2018; 148 in 2019; 74 in 2020 (1 January to 15 September)

Casualties by type of incident
• Shelling: 66 killed and 452 injured
• Small arms and light weapons: 11 killed and 96 injured
• Mines, unexploded ordnance and other explosive objects: 81 killed and 231 injured
• Other: three killed and six injured

Civilian casualties by region and control
• 750 in Donetsk region and 196 in Luhansk region
• Government-controlled areas: 223 in Donetsk region and 47 in Luhansk region
• Non-government-controlled areas: 513 in Donetsk region and 144 in Luhansk region
• Areas not controlled by either side: 14 in Donetsk region and five in Luhansk region

Casualties by sex and age
• 531 men; 315 women; and 100 children (73 boys and 27 girls)
• 72 per cent of adult civilians killed or injured by mines and unexploded ordnance (UXO) were men;
among minors, 90 per cent were boys
• More than 40 per cent of cases where men were killed or injured by mines and UXOs were due to mis￾handling or attempting to dismantle these objects; this amounted to 87 per cent of cases among boys
• Over 70 per cent of civilians killed or injured by mines or other explosive objects along riverbanks were
men

www.osce.org/files/f/documents/f/b/469734.pdf


I have been reading OSCE reports off and on (off times because of family illness) since 2014. Civilians have been killed on both sides. And sorry, civilians targets hit. Note the above does not include 2014-2015, when civilian casualties per year were reportedly higher than in later years.

Here’s pro-Ukraine BBC:

Ukraine crisis: Children die in Donetsk shelling

https://www.bbc.com/news/world-europe-29912055

I suppose you think AI and HRW are “Russian propaganda” outlets? Now that’s funny!

For some reason, you want to believe Ukrainians are all pure angels and Russians are all pure devils. Well, that’s the comic book mentality that seems to have taken over.


34 posted on 12/26/2023 1:17:10 PM PST by CatHerd (Whoever said "All's fair in love and war" probably never participated in either.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: freeandfreezing

This is so weird. I never denied the boat was hit. Maybe you have me confused with someone else?


35 posted on 12/26/2023 1:18:15 PM PST by CatHerd (Whoever said "All's fair in love and war" probably never participated in either.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Eleutheria5

Good to see some more movement. Bad to see ships still in Crimea. Was it “destroyed” or only “damaged”? Impossible to say without pictures.

Annihilated as per this video.

Ropucha-class Landing Ship Novocherkassk Confirmed SUNK By Storm Shadow in Photo
https://www.youtube.com/watch?v=4RlFtg6CJ7I


36 posted on 12/26/2023 2:40:24 PM PST by Steven Scharf
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

The damaged ship spontaneously spread chunks of itself all around the city in a goodwill gesture and in the hopes that the people could put the jigsaw puzzle back together again, along with the pieces of meat from the former crew.


37 posted on 12/26/2023 2:45:35 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 1 | View Replies]

To: PIF

Kind of itself to share so freely.


38 posted on 12/26/2023 4:14:20 PM PST by Eleutheria5 (Every Goliath has his David. Child in need of a CGM system. https://gofund.me/6452dbf1. )
[ Post Reply | Private Reply | To 37 | View Replies]

To: CatHerd
Notice that your own sources that you chose show that shelling is a minor cause of deaths before the 2022 Russian invasion.

And you cited material doesn't show how many deaths and injuries due to shelling occurred as a result of shelling from Ukrainian government controlled territory. Most deaths and injuries from shelling before the 2022 invasion resulted from shelling started by Russians and their allies.

You did leave out the locations of the greatest numbers of civilian casualties. Places like Avdiivka, which the OSCE listed as one of the worst places for civilian deaths and injuries due to shelling. Then as now Avdiivka was controlled by the Ukrainian government, so the incoming shells were fired by Russians.

Since the Russian invasion the number of civilians killed by Russian shelling has become much, much larger. Take a look at any city or town in Donetsk where the Russians are attacking:

Shelling of the Donetsk region: 4 people were killed, three were wounded

On the morning of December 26, the Russian military fired artillery at the city of Toretsk in the Bakhmut district of the Donetsk region. As a result, two pensioners died: a 67-year-old woman and a 74-year-old man. The Office of the Prosecutor General of Ukraine writes about this on Facebook. At the same time, another local resident died in the suburb of Toretsk, in the village of Severnoye. One person was injured.

A few hours later Avdeevka came under fire. A 61-year-old man died; rescuers rescued his wife, who was seriously injured, from the rubble of their house. In addition, a 61-year-old woman died during shelling of the village of Konstantinovka, Pokrovsky district of the region.

Source

That's 4 dead Ukrainian civilians in one day. During the period from July 2020 to Sept. 2020 only one person was injured. And he was injured by Russian shelling in Marinka.

How many civilians in Ukraine died from shelling in 2012, before Russia seized Crimea and started the violence in the Donbass? Zero.

39 posted on 12/26/2023 4:24:10 PM PST by freeandfreezing
[ Post Reply | Private Reply | To 34 | View Replies]

To: Eleutheria5

Huh?


40 posted on 12/26/2023 7:20:07 PM PST by for-q-clinton (Cancel Culture IS fascism...Let's start calling it that!)
[ Post Reply | Private Reply | To 32 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-44 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson