Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Evidence of New Human Species Found in Philippines
Wall Street Journal ^ | April 10, 2019 1:00 p.m. ET | Robert Lee Hotz

Posted on 04/10/2019 12:39:58 PM PDT by Candor7

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-66 next last
To: mewzilla

The foot bone is curved and one of the teeth has three roots. I just don’t believe things evolved that quickly.

You don’t see people with curved bones and growing different root systems for their teeth.


41 posted on 04/10/2019 4:19:50 PM PDT by boycott
[ Post Reply | Private Reply | To 19 | View Replies]

To: Oldeconomybuyer

As a teen, I wouldn’t mind dating her...


42 posted on 04/10/2019 4:44:57 PM PDT by ConservaTeen (WFLA's Jack Harris: Brooklyn is missing their village idiot. Right you are, Jack.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: litehaus
And I believe running the House in DC, too... 😀
43 posted on 04/10/2019 4:46:15 PM PDT by ConservaTeen (WFLA's Jack Harris: Brooklyn is missing their village idiot. Right you are, Jack.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Buffalo Head
Hey, you think we can't have fun? What's wrong with adolescent humor? The Dems has a few in the house (Alexandria Ocasio-Cortez for one) 😀
44 posted on 04/10/2019 4:48:27 PM PDT by ConservaTeen (WFLA's Jack Harris: Brooklyn is missing their village idiot. Right you are, Jack.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: blam; StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; ...
Thanks blam.

45 posted on 04/10/2019 11:11:41 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: xenia
Strange that no other human species “kinds” managed to survive.

Odds are good that we killed (and probably ate) them all.

46 posted on 04/11/2019 5:58:45 AM PDT by null and void (If socialism is so grand, why are Guatemalans coming here instead of going to Venezuela?)
[ Post Reply | Private Reply | To 20 | View Replies]

To: mewzilla
From your link:
47 posted on 04/11/2019 7:06:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19 | View Replies]

To: null and void; xenia; Red Badger; Fred Nerks; SunkenCiv; blam; BenLurkin; All

At the least the Neanderthal and the Denisovan are still alive in our genes. I recently read that some current populations may have almost 500 Denisovan genes, and that most humans today have 1 to 4% Neanderthal genes. Don’t we have about 20,000. A recent article said that Neanderthal gave light skin, red hair and blue eyes. My late husband had all those, plus an extremely muscular body, big bones, long torso, short legs, very hard teeth and head, receding chin, slight brow ridges, crystaline teeth, early maturation, and an explosive temper. His ancestry was northern Scotch/Viking. I suspect he was more than 4% Neanderthal, I wish I had some of his DNA to send to one of those Ancestry companies.


48 posted on 04/11/2019 5:10:11 PM PDT by gleeaikin
[ Post Reply | Private Reply | To 46 | View Replies]

To: ConservaTeen
"What's wrong with adolescent humor?"

Lots if you are concerned about the long term viability of this forum. Most adults are turned off by adolescent humor and turn elsewhere for news and important Conservative information.

49 posted on 04/11/2019 8:56:24 PM PDT by Buffalo Head (Illegitimi non carborundum)
[ Post Reply | Private Reply | To 44 | View Replies]

To: gleeaikin
I haVe Denisovan genes. As more DNA is found in old remains, I'd be surprised if more and more people show descent from various human varieties. It's not as if the pre-DNA-testing evidence wasn't there, the bias to avoid recognizing it was, though, and some people still have that, even in the face of the DNA evidence.
KEYWORDS: neandertal; neandertals; neanderthal; neanderthals
The Neandertal Enigma
by James Shreeve

in local libraries
"Frayer's own reading of the record reveals a number of overlooked traits that clearly and specifically link the Neandertals to the Cro-Magnons. One such trait is the shape of the opening of the nerve canal in the lower jaw, a spot where dentists often give a pain-blocking injection. In many Neandertal, the upper portion of the opening is covered by a broad bony ridge, a curious feature also carried by a significant number of Cro-Magnons. But none of the alleged 'ancestors of us all' fossils from Africa have it, and it is extremely rare in modern people outside Europe." [pp 126-127]

50 posted on 04/11/2019 9:11:37 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 48 | View Replies]

To: gleeaikin
Tennessee Pygmy relation to Philippines and Malaysian Pygmies

Pygmy Skeletons

One far flung theory is presented by Virgilio R. Pilapil, who asserts that the Tennessee graves did contain pygmy remains, and that the pygmies arrived in ancient times from southeast Asia, where today's diminutive Aetas live.

To support his case, Pilapil recalls Barry Fell's examination of the Tennessee skeletal material. Fell noted that: (1) The skull brain capacity was equivalent to only about 950 cubic centimeters, about the volume of a non-pygmy 7-year old; (2) The teeth were completely developed and showed severe wear characteristic of mature individuals; and (3) The skulls were brachycephalic with projecting jaws. Which actually describes the skulls of Modern Adult Philippine Aetas.

"Pygmy skulls from Tennessee, have been found that match a race of pygmies from the Philippines and Malaysia. The Malaysian and Philippine pygmies are regarded by archaeologists as remnants of a formerly extensive Mongoloid pygmy race that once occupied much of southern East Asia. Some Scholars believe that their characteristics can still be recognized in the sporadic dark skin, squat stature and nappy hair observed among some southern Chinese. However, there's a further riddle of the Tennessee pygmies - they were found in association with " Europoids and inscribed artifacts of Europoid type"

Above paragraph was adapted from EUROPEAN BRONZE AGE VISITORS IN AMERICA

51 posted on 04/11/2019 9:44:49 PM PDT by Fred Nerks (FAIR DINKUM)
[ Post Reply | Private Reply | To 48 | View Replies]

To: gleeaikin

Whoops, “I’d be surprised if more and more people show descent” should have been “I’d be surprised if more and more people don’t show descent”.


52 posted on 04/11/2019 10:05:02 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 48 | View Replies]

To: Fred Nerks
Thanks Fred Nerks!

53 posted on 04/11/2019 10:07:51 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Fred Nerks; SunkenCiv; blam; Red Badger; All

So, have these skeletons been C14 dated? Also, was there a time estimated for when these skeletons/bodies were buried? Could they have been brought back by an American seafarer who spent time in the Far East. Who did the varnish job?


54 posted on 04/12/2019 12:15:33 AM PDT by gleeaikin
[ Post Reply | Private Reply | To 51 | View Replies]

To: gleeaikin

If you have any personal articles of his, tooth, false teeth, comb, brush, even hair, they can get DNA from it..............


55 posted on 04/12/2019 6:29:35 AM PDT by Red Badger (We are headed for a Civil War. It won't be nice like the last one....................)
[ Post Reply | Private Reply | To 48 | View Replies]

To: Red Badger; SunkenCiv; blam; All

The most likely article I have is a beret with a shinny hatband inside. Do the commercial Ancestry places take that kind of artifact? Also can you get DNA from chunks, possibly teeth left in cremains?


56 posted on 04/12/2019 8:28:02 AM PDT by gleeaikin
[ Post Reply | Private Reply | To 55 | View Replies]

To: gleeaikin

Teeth in cremains? Not if it was burned, DNA was destroyed.

The hatband would be ideal, if no one else has worn it since.

Just swab the kit’s provided swap all over it to get maximum sample....................


57 posted on 04/12/2019 8:33:10 AM PDT by Red Badger (We are headed for a Civil War. It won't be nice like the last one....................)
[ Post Reply | Private Reply | To 56 | View Replies]

To: gleeaikin
The varnish job was probably done locally -- had the remains been handed over to the Smithsonian, they'd have been dumped in the Atlantic.

58 posted on 04/12/2019 9:20:03 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 54 | View Replies]

To: gleeaikin; SunkenCiv; Red Badger
"Also can you get DNA from chunks, possibly teeth left in cremains?"

See below. They're getting DNA everywhere these days.

Dust To Dust: Scientists Find DNA Of Human Ancestors In Cave Floor Dirt

59 posted on 04/12/2019 10:54:12 AM PDT by blam
[ Post Reply | Private Reply | To 56 | View Replies]

To: blam

Wouldn’t that DNA be dirty?................


60 posted on 04/12/2019 10:57:24 AM PDT by Red Badger (We are headed for a Civil War. It won't be nice like the last one....................)
[ Post Reply | Private Reply | To 59 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-66 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson