Free Republic
Browse · Search
News/Activism
Topics · Post Article

"Muslims who say this has nothing to do with Islam are simply trying to liberate their consciences to say they disagree with them," he told the Register. "That they disagree is fine, but to say ISIS are not representing Islam is wrong. They are not representing the whole Islam; no one represents the whole Islam. The same could be said for Christians. But what is for sure is that they do have a fundament in the Islamic tradition, sometimes clearly taking instructions from the Quran, such as when they kill a nonbeliever."

1 posted on 11/21/2015 1:06:34 AM PST by GonzoII
[ Post Reply | Private Reply | View Replies ]


To: GonzoII

Mohammed was a terrorist. Wasn’t he Islamic?


2 posted on 11/21/2015 1:07:38 AM PST by TigersEye (This is the age of the death of reason and rule of law. Prepare!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Moselm control of the Mediterranean threw Europe into the dark ages. Moslem golden ages are propaganda talking points directed to the uninformed, the unchurched and the ignorant.


7 posted on 11/21/2015 1:34:22 AM PST by x_plus_one (The hammer of heretics, the light of Spain, the savior of his country, the honor of his order..)
[ Post Reply | Private Reply | To 1 | View Replies ]

Islam is a war plan.


8 posted on 11/21/2015 1:34:31 AM PST by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

[ To equate the attacks with “views of Islam” creates “stereotypes” that are “counterproductive” and “wrong,” Obama told reporters at the G20 Summit in Antalya, Turkey, Nov. 16 ]

BZZZTTT WRONG!

It puts PRESSURE on the so called MODERATES in ISLAM to clamp DOWN and SPEAK UP Against the Extremists that are giving THEM ALL a bad name!!!

Why must CHRISTIANS or JEWS be the ONLY SHAMED religion when ANYONE who is CHRISTIAN or a JEW does a BAD DEED?????

Maybe the “rare as a unicorn moderate Muslims” would get sick and tired of the people doing bad acts in the name of Islam and DO SOMETHING to REFORM their damned religion and bring it forward a few hundred damned years!!!


10 posted on 11/21/2015 2:11:58 AM PST by GraceG (Protect the Border from Illegal Aliens, Don't Protect Illegal Alien Boarders...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

12 posted on 11/21/2015 2:17:42 AM PST by Slings and Arrows (My music: http://hopalongginsberg.com/ | Facebook: Hopalong Ginsberg | Instagram: hopalonginsberg)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Does it matter? Or as Hillary likes to ask, What difference does it make? (Kill ‘em all! and let Allah sort ‘em out.)


15 posted on 11/21/2015 2:44:56 AM PST by shalom aleichem
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Just read their operating manual and you know where all that stuff comes from. It IS Islam.


18 posted on 11/21/2015 2:52:43 AM PST by arthurus (Het is waar. Tutti i liberali sono feccia.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

The Oregon killer asked his victims if they were Christian.

In Mali, they made people recite from the Quran in order to go free.

Obama is practicing Taqiyyah.


19 posted on 11/21/2015 2:53:38 AM PST by firebrand
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

The head of ISIS has a PhD in Islamic Studies from the Islamic University in Baghdad.


24 posted on 11/21/2015 3:44:38 AM PST by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII
HERE'S your answer
25 posted on 11/21/2015 3:47:33 AM PST by knarf (I say things that are true .... I have no proof ... but they're true.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Obama gave Osama Bin Laden a respectful Islamic funeral (at taxpayer expense) so as not to p!ss off Islamic terrorists.

Now why is that if Osama and the other terrorists aren’t really Islamic?


30 posted on 11/21/2015 4:44:34 AM PST by a fool in paradise (The goal of Socialism is Communism. Marx and Lenin were in agreement on this.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

If rogue Catholics set up a a self-proclaimed “Catholic State” somewhere, and proceeded to rape, behead and mass-murder everybody who disagreed, millions of good Catholics from all over the world would rise up, take arms, go there and destroy them.

Muslim passivity toward the Islamic State damns them by their silence.

After Paris, an anti-terrorism rally by Muslims drew THIRTY participants. Compared to thousands who protested against cartoons of Mohammed.


33 posted on 11/21/2015 4:52:21 AM PST by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

How Islamic Are Islamic Terrorists? 100%

How Islamic Are Islamic Moderates? 0%


35 posted on 11/21/2015 5:39:19 AM PST by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Do a Majority of Young French Muslims Support ISIS?

FrontPage Magazine-Nov 17, 2015

In the 18-to-24-year-old demographic, ISIS’ support jumped to 27%. Muslims comprise about a tenth of France’s population, so the results imply ...


36 posted on 11/21/2015 6:10:56 AM PST by stocksthatgoup (When the MSM and GOPe want your opinion they will give it to you.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

A typical suicidal terrorist is often driven by a belief that they have been a sinner earlier and the only way to go to Paradise is to be martyred (= killed for Allah) “

http://www.freerepublic.com/focus/news/3362440/posts?page=3#3


37 posted on 11/21/2015 6:43:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

They are exactly like the original Moohamhead led Muslims, just with smart phones and guns.


38 posted on 11/21/2015 6:50:46 AM PST by Impy (They pull a knife, you pull a gun. That's the CHICAGO WAY, and that's how you beat the rats!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Important point about “Enlightenment thinking.” It’s also what Barry and his ilk engage in and why his policies are so badly flawed. Frankly, much that is wrong in the world harks back to it.


39 posted on 11/21/2015 7:05:49 AM PST by FourPeas ("Conservatism's worked every time it's been tried." -Rush)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: GonzoII

Really! To what ‘religion’ are they demanding submission ? Not Christianity
What ‘holy book’ are they following? What must the world obey if not Islam? That is the contaminant that must be cleansed from the planet.


45 posted on 11/21/2015 4:00:02 PM PST by ClearBlueSky (Whenever someone says it's not about Islam- it's about Islam. That death cult must be eradicated.)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson