Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: elhombrelibre; SunkenCiv; gandalftb; nuconvert; TigerLikesRooster; Greetings_Puny_Humans; GeronL; ..
This will work:

U.K. Wants EU to Block Russia From SWIFT Banking Network http://www.bloomberg.com/news/2014-08-29/u-k-wants-eu-to-block-russia-from-swift-banking-network.html

and increase the oil production:

The main cause for the recent fall in oil prices is that weakening demand is being met by rising production. West African crude exports to Asia were near record levels in September, a Reuters survey of traders showed, and the North Sea market remained well supplied.

Production from the Organization of the Petroleum Exporting Countries (OPEC) rose, despite conflicts in Iraq and Libya.
OPEC, which supplies a third of the world's oil, raised its output in August from July, with higher supply from Libya, Angola and Iran, a Reuters survey found.

http://www.dailytimes.com.pk/business/30-Aug-2014/brent-oil-rises-on-ukraine-crisis-but-heads-for-monthly-fall

the result will be this:

“With the significant deterioration in the Ukrainian situation, markets may treat this as a Lehman-style shock,” Kantarovich wrote in an e-mailed report Friday. “Revisiting the post-Lehman lows would imply downside of 50 percent from an index perspective.”

The bank recommends reducing Russian investments because “markets may no longer assume a quick and easy resolution of the conflict and ‘worse before better’ seems a likely sequence.”

http://www.Newsmax.com/Finance/JPMorgan-Russia-Ukraine-stocks/2014/08/29/id/591641

38 posted on 08/30/2014 2:03:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]


To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks AdmSmith.


43 posted on 08/30/2014 12:16:06 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | To 38 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson