Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Da Coyote
Da Coyote:" “Yep let’s keep those borders nice and OPEN.."

"The CDC has confirmed 182 cases of AFM so far this year.
Outbreaks have occurred most frequently in the summer and fall."

Possibly a correlation with illegal immigrant travel ?

10 posted on 12/28/2018 9:29:07 AM PST by Tilted Irish Kilt
[ Post Reply | Private Reply | To 6 | View Replies ]


To: Tilted Irish Kilt

Many diseases can be followed by the school calendar.


21 posted on 12/28/2018 9:55:53 AM PST by bgill (CDC site, "We don't know. how people are infected with Ebola.")
[ Post Reply | Private Reply | To 10 | View Replies ]

To: Tilted Irish Kilt

Most patients had onset of AFM between August and October, with increases in AFM cases every two years since 2014. At this same time of year, many viruses commonly circulate, including enteroviruses, and will be temporally associated with AFM.
https://www.cdc.gov/acute-flaccid-myelitis/about-afm.html

This indicates that the vector is an insect or an animal with population variation every second year.


33 posted on 12/31/2018 1:37:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson