Free Republic
Browse · Search
General/Chat
Topics · Post Article

Although Zika was first identified in Uganda in 1947, researchers in 2012 discovered a second distinct Asian lineage of the virus which is the one that has been linked to neurological problems in Brazil and is the same strain that has been identified in Cape Verde, according to the World Health Organization.

"It is my analysis that we're at the beginning of a really challenging new outbreak with probably substantial impacts that are not fully understood by the world as a whole, even by those who are experts in bio-medical research," said Dr. David Nabarro, a special adviser to U.N. Secretary-General Ban Ki-moon on health issues.

Zika virus is spread mainly through the bite of a tropical mosquito, Aedes aegypti, and was first thought to cause only mild symptoms like a fever and rash, but it has recently been linked to severe birth defects including babies born with abnormally small heads and a rare neurological syndrome that can cause death or temporary paralysis.

1 posted on 06/20/2016 1:51:47 PM PDT by Tilted Irish Kilt
[ Post Reply | Private Reply | View Replies ]


To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...

Infectious Disease Ping

” Experts only beginning to grasp the damage from Zika virus “


2 posted on 06/20/2016 1:53:28 PM PDT by Tilted Irish Kilt ( British historian Arnold Toynbee - Civilisations die from suicide, not by murder.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Do the Olympics have their goofy mascot picked out yet. Maybe it can be named Zika.


3 posted on 06/20/2016 1:53:33 PM PDT by lacrew
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

I say that if the virus can do that to a developing baby, it is probably not wholly benign to adults, either.


4 posted on 06/20/2016 1:53:34 PM PDT by fwdude (If we keep insisting on the lesser of two evils, that is exactly what they will give us from now on.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Spray whole rainforests worldwide with pesticides. But, wait, some endangered flies might have hairloss. Oh noes.


5 posted on 06/20/2016 1:54:06 PM PDT by sagar
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

The wild spread and devastation of this virus that is transmitted by mosquitoes is the result of the pseudoscience that resulted in the banning of DDT.


6 posted on 06/20/2016 1:56:02 PM PDT by allendale
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt; SunkenCiv; nuconvert

This is an interesting idea that should be discussed:

Kill All the Mosquitoes?!
New gene-editing technology gives scientists the ability to wipe out the carriers of malaria and the Zika virus. But should they use it?

http://www.smithsonianmag.com/innovation/kill-all-mosquitos-180959069/?no-ist


9 posted on 06/20/2016 1:59:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Our government is to blame for every tragedy here. They knew foreign people were coming in with it and did nothing!


10 posted on 06/20/2016 2:01:03 PM PDT by WENDLE (Ban Wahhabis . Not guns!! Profile them!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Like EV-D68 and incurable tuberculosis, the
GOP Congress and White Mosque want it in EVERY school
by secret Quartering.

Americans have not yet grasped the damage
to all future generations by
the negligent, self-serving GOP and the White Mosque.


11 posted on 06/20/2016 2:07:37 PM PDT by Diogenesis ("When a crime is unpunished, the world is unbalanced.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Thanks for the ping.


17 posted on 06/20/2016 2:14:29 PM PDT by PA Engineer (Liberate America from the Occupation Media. #2ndAmendmentMatters)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

If it gets into Africa the results could easily be akin to the Black Plague, given the birth rate and the lack of modern medical culture.


20 posted on 06/20/2016 2:18:47 PM PDT by Don Corleone (Oil the gun, eat the cannolis, take it to the mattress.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Might be time to dust off the DDT sprayers.


24 posted on 06/20/2016 2:27:08 PM PDT by Georgia Girl 2 (The only purpose of a pistol is to fight your way back to the rifle you should never have dropped)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

If they can’t support a place with tourism, maybe they should allow residents to produce something instead.


26 posted on 06/20/2016 2:32:31 PM PDT by familyop ("Welcome to Costco. I love you." --Costco greeter in the movie, "Idiocracy")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

we’re doomed. again.


28 posted on 06/20/2016 2:37:20 PM PDT by JohnBrowdie (http://forum.stink-eye.net)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt; Lazamataz

Think about this. Put these together.

How much money and effort do you think the govt of Venezuela is putting into anti-Zika programs in the summer of 2016? While they are having starvation food riots?

Zero.

So, not only is Zika coming, but we have reintroduced many other diseases with our wide-open borders and insane unscreened refugee programs.

If we have a financial collapse, EBT down, food riots, etc. (Venezuala X 50), how will we deal with rampant epidemics?

Anybody thinking out five-six years, to the midst of a financial collapse, with all these infectious bugs let loose?

Any brainiacs on TV talking about it?

No.


29 posted on 06/20/2016 2:46:32 PM PDT by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

very bad: https://www.google.com/maps/d/viewer?hl=en&hl=en&authuser=0&authuser=0&mid=1FlIB7hHnVgGD9TlbSx5HwAj-PEQ

http://recombinomics.co/topic/1543-florida-zika-cases-increase-to-199/#comment-6122


36 posted on 06/20/2016 3:18:09 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

“rare neurological syndrome that can cause death or temporary paralysis.”

That may be GBS or Guillain-Barré (Ghee-yan Bah-ray) Syndrome is an inflammatory disorder of the peripheral nerves outside the brain and spinal cord.

It’s also called:

Acute Inflammatory Demyelinating Polyneuropathy
Landry’s Ascending Paralysis

GBS is characterized by the rapid onset of numbness, weakness, and often paralysis of the legs, arms, breathing muscles, and face. Paralysis is ascending, meaning that it travels up the limbs from fingers and toes towards the torso.GBS came to public attention briefly when it struck a number of people who received the 1976 swine flu vaccine. Although not in the news as much today, it continues to claim thousands of new victims each year, striking any one at any age, regardless of gender or ethnic background.

The rapid onset of weakness, frequently accompanied by abnormal sensations (numbness, tingling) that affect both sides of the body similarly, is common. Loss of reflexes, such as the knee jerk, are usually found.

http://www.gbs-cidp.org/gbs/all-about-gbs/

I got this lovely affliction in 1976 after getting a swine flu shot. I was miserable for about 2 months, and decades later, when I am really tired, my upper jawbones feel like an oral surgeon had worked on them and the lidocaine is slowly wearing off.

Flash forward to this year, a friend with Parkinson’s Disease ends up in the hospital and can’t swallow solid food. After listening his wife describe his symptoms, I asked his wife if he had a flu shot. She said no, I wrote down GBS and suggested she ask her husband’s neurologist about GBS as factor. The neurologist agreed that was the problem.

Another friend had a stroke and besides the normal stroke problems she couldn’t swallow. I informed her family and about our mutual friend, and they asked the doctors, and they kept her on a liquid diet for a month.

Both are coming around. We have had one case of Zika Virus diagnosed in our county, and the biggest outpatient lab does not test for the virus.


39 posted on 06/20/2016 3:29:07 PM PDT by Grampa Dave (La Raza thugs in America are Mexico's form of Isis terrorism/terrorists/invaders!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson