Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Experts only beginning to grasp the damage from Zika virus
Associated Press ^ | Jun 20, 3:49 PM EDT | MICHAEL ASTOR

Posted on 06/20/2016 1:51:47 PM PDT by Tilted Irish Kilt

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041-45 next last
Although Zika was first identified in Uganda in 1947, researchers in 2012 discovered a second distinct Asian lineage of the virus which is the one that has been linked to neurological problems in Brazil and is the same strain that has been identified in Cape Verde, according to the World Health Organization.

"It is my analysis that we're at the beginning of a really challenging new outbreak with probably substantial impacts that are not fully understood by the world as a whole, even by those who are experts in bio-medical research," said Dr. David Nabarro, a special adviser to U.N. Secretary-General Ban Ki-moon on health issues.

Zika virus is spread mainly through the bite of a tropical mosquito, Aedes aegypti, and was first thought to cause only mild symptoms like a fever and rash, but it has recently been linked to severe birth defects including babies born with abnormally small heads and a rare neurological syndrome that can cause death or temporary paralysis.

1 posted on 06/20/2016 1:51:47 PM PDT by Tilted Irish Kilt
[ Post Reply | Private Reply | View Replies]

To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...

Infectious Disease Ping

” Experts only beginning to grasp the damage from Zika virus “


2 posted on 06/20/2016 1:53:28 PM PDT by Tilted Irish Kilt ( British historian Arnold Toynbee - Civilisations die from suicide, not by murder.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

Do the Olympics have their goofy mascot picked out yet. Maybe it can be named Zika.


3 posted on 06/20/2016 1:53:33 PM PDT by lacrew
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

I say that if the virus can do that to a developing baby, it is probably not wholly benign to adults, either.


4 posted on 06/20/2016 1:53:34 PM PDT by fwdude (If we keep insisting on the lesser of two evils, that is exactly what they will give us from now on.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

Spray whole rainforests worldwide with pesticides. But, wait, some endangered flies might have hairloss. Oh noes.


5 posted on 06/20/2016 1:54:06 PM PDT by sagar
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

The wild spread and devastation of this virus that is transmitted by mosquitoes is the result of the pseudoscience that resulted in the banning of DDT.


6 posted on 06/20/2016 1:56:02 PM PDT by allendale
[ Post Reply | Private Reply | To 1 | View Replies]

To: lacrew

good one!


7 posted on 06/20/2016 1:57:34 PM PDT by ColdOne (poochie... Tasha 2000~3/14/11 HillaryForPrison2016)
[ Post Reply | Private Reply | To 3 | View Replies]

To: fwdude
I'd say that if the virus can do that to a developing baby, it is probably not wholly benign to adults, either

The damage it does to a baby in the womb is a short term effect of the virus. I can't imagine that they have a clue as to the long-term impacts of this virus. Another unknown....does this virus spread to animals that are bitten by infected mosquitoes?

This is beginning to shape up like something right out of Science Fiction.

8 posted on 06/20/2016 1:59:49 PM PDT by grania
[ Post Reply | Private Reply | To 4 | View Replies]

To: Tilted Irish Kilt; SunkenCiv; nuconvert

This is an interesting idea that should be discussed:

Kill All the Mosquitoes?!
New gene-editing technology gives scientists the ability to wipe out the carriers of malaria and the Zika virus. But should they use it?

http://www.smithsonianmag.com/innovation/kill-all-mosquitos-180959069/?no-ist


9 posted on 06/20/2016 1:59:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

Our government is to blame for every tragedy here. They knew foreign people were coming in with it and did nothing!


10 posted on 06/20/2016 2:01:03 PM PDT by WENDLE (Ban Wahhabis . Not guns!! Profile them!!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

Like EV-D68 and incurable tuberculosis, the
GOP Congress and White Mosque want it in EVERY school
by secret Quartering.

Americans have not yet grasped the damage
to all future generations by
the negligent, self-serving GOP and the White Mosque.


11 posted on 06/20/2016 2:07:37 PM PDT by Diogenesis ("When a crime is unpunished, the world is unbalanced.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: allendale
The wild spread and devastation of this virus that is transmitted by mosquitoes is the result of the pseudoscience that resulted in the banning of DDT.

Good point. I was amazed to read how safe and effective DDT is and was. And it looks like we still need it.

12 posted on 06/20/2016 2:08:28 PM PDT by Talisker (One who commands, must obey.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: lacrew

Summer Games ... don’t mind the maggots!


13 posted on 06/20/2016 2:09:43 PM PDT by oscar_diggs
[ Post Reply | Private Reply | To 3 | View Replies]

To: lacrew
Do the Olympics have their goofy mascot picked out yet.

I suppose a little pinhead kid is out of the question.

14 posted on 06/20/2016 2:12:05 PM PDT by humblegunner
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
there is some speculation that modified mosquitoes may have CAUSED or exacerbated the spread of zika.

http://theantimedia.org/zika-outbreak-epicenter-in-same-area-where-gm-mosquitoes-were-released-in-2015/

15 posted on 06/20/2016 2:13:29 PM PDT by garyb
[ Post Reply | Private Reply | To 9 | View Replies]

To: Diogenesis

Like EV-D68 and incurable tuberculosis, the
GOP Congress and White Mosque want it in EVERY school
by secret Quartering.
**************
I had that talk with my doctor last week about whooping cough... I said I don’t hang with too many Mexicans ,, I got an evil look and “that’s not how it spreads..” so I answered “Guatemalans?” ....


16 posted on 06/20/2016 2:13:54 PM PDT by oscar_diggs
[ Post Reply | Private Reply | To 11 | View Replies]

To: Tilted Irish Kilt

Thanks for the ping.


17 posted on 06/20/2016 2:14:29 PM PDT by PA Engineer (Liberate America from the Occupation Media. #2ndAmendmentMatters)
[ Post Reply | Private Reply | To 1 | View Replies]

To: garyb

So this means the great human murderer who caused the ban of DDT will be responsible for many, many more deaths. That degenerate LIB moonbat idiot was Rachel Carson.


18 posted on 06/20/2016 2:15:26 PM PDT by hal ogen (First Amendment or Reeducation Camp?.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Diogenesis
Diogenesis : "Americans have not yet grasped the damage
to all future generations by
the negligent, self-serving GOP and the White Mosque..."

I agree.
That is why Obama said that he was going to 'transform America'
and should be named the "Plague President "
for disease, pestilence, uncontrolled debt,
and a "quisling complicit Congress" (both parties become the uni-party).

19 posted on 06/20/2016 2:17:04 PM PDT by Tilted Irish Kilt ( British historian Arnold Toynbee - Civilisations die from suicide, not by murder.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Tilted Irish Kilt

If it gets into Africa the results could easily be akin to the Black Plague, given the birth rate and the lack of modern medical culture.


20 posted on 06/20/2016 2:18:47 PM PDT by Don Corleone (Oil the gun, eat the cannolis, take it to the mattress.)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-45 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson