Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Orlando Shooter Was a Skilled Marksman Who Had Trouble in School
ABC News ^ | June 16, 2016 | Aaron Katersky, Ben Stein, Linzie Janis and Meghan Keneally

Posted on 06/16/2016 10:29:13 PM PDT by 2ndDivisionVet

Newly obtained information from the Orlando nightclub shooter's school and work records show he caused trouble at an early age and, as an adult, became a proficient marksman with consistently high scores in tests.

As far back as 1992, when he was in elementary school, teachers described Omar Mateen as a “disruptive influence” or “classroom disruption” and cited him for “repeat misconduct,” using profanity and even striking another student, according to St. Lucie County school records obtained by ABC News.

He had two marks on the records during the 1992-1993 school year. Between 1996 and 1998, when Mateen was in 5th through 7th grades, the record is filled with incidents and complaints from teachers and school officials -- more than 30 of them. He left St. Lucie County schools in 1999 and transferred to another district in 8th grade.

In a letter sent to Mateen’s father in 1999, a Southport Middle School official wrote, “Omar’s attitude and inability to show self-control in the classroom create distractions and become a main source of difficulty for him.”(continued)

(Excerpt) Read more at abcnews.go.com ...


TOPICS: Chit/Chat; Government; Local News
KEYWORDS: massacre; mateen; orlando
Navigation: use the links below to view more comments.
first 1-2021-30 next last

1 posted on 06/16/2016 10:29:13 PM PDT by 2ndDivisionVet
[ Post Reply | Private Reply | View Replies]

To: 2ndDivisionVet

Whew! For a while there I was thinking he was a Muslim terrorist. I am glad abc cleared him.


2 posted on 06/16/2016 10:32:57 PM PDT by boycott (--s)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet
Elementary school classmate says Omar Mateen was suspended for threatening to go on shooting rampage

High School Classmate of Omar Mateen: He Cheered 9-11 Attacks

3 posted on 06/16/2016 10:35:17 PM PDT by TigersEye (This is the age of the death of reason and rule of law. Prepare!)
[ Post Reply | Private Reply | To 1 | View Replies]

A memo from ABC Disney — an operation that can’t control its wildlife.


4 posted on 06/16/2016 10:36:52 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

Elementary school ? He was 29 years old. Probably did not remember anything about elementary school.


5 posted on 06/16/2016 10:42:09 PM PDT by justa-hairyape (The user name is sarcastic. Although at times it may not appear that way.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet
Many suicide bombers are criminals or have done something against the regulations in the Quran that would make it impossible for them to go to the paradise, not to mention meeting the 72 grapes https://www.theguardian.com/books/2002/jan/12/books.guardianreview5

They are brainwashed to believe that martyrship is their only salvation.
http://www.thereligionofpeace.com/pages/quran/suicide-bombing.aspx

6 posted on 06/16/2016 10:43:04 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

7 posted on 06/16/2016 10:48:42 PM PDT by inkfarmer
[ Post Reply | Private Reply | To 1 | View Replies]

To: boycott

My gosh going back to his grades. He’s a terrorist. That enough.


8 posted on 06/16/2016 10:57:26 PM PDT by napscoordinator (Trump/Hunter, jr for President/Vice President 2016)
[ Post Reply | Private Reply | To 2 | View Replies]

To: 2ndDivisionVet

9 posted on 06/16/2016 11:36:47 PM PDT by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

“Marksman.” That’s what we heard constantly about Oswald. It’s the lowest category, isn’t it?


10 posted on 06/16/2016 11:49:30 PM PDT by Arthur McGowan
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

One of the networks said that he was suspended at least a dozen times over the last five years of high school.

In my day....if you got suspended on one single occasion....you got dragged into the principal’s office and read the riot act...the second suspension meant you didn’t come back to his school and the other schools in the county had the right to refuse you.


11 posted on 06/17/2016 12:33:18 AM PDT by pepsionice
[ Post Reply | Private Reply | To 1 | View Replies]

To: Travis McGee

Ban Liberals...


12 posted on 06/17/2016 1:25:36 AM PDT by VRWC For Truth (FUBO)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

That’s what I think.


13 posted on 06/17/2016 2:21:52 AM PDT by Eagles6 ( Valley Forge Redux. If not now, when? If not here, where? If not us then who?)
[ Post Reply | Private Reply | To 6 | View Replies]

To: pepsionice

That was before standards of behavior were considered racist.


14 posted on 06/17/2016 2:48:34 AM PDT by Brooklyn Attitude (The first step in ending the War on White People, is to recognize it exists.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: TigersEye

The MSM bias never ceases to amaze.

They and their overlords at DNC headquarters working overtime to turn this Islamonazi into just another sicko with a Republican gun.


15 posted on 06/17/2016 3:38:29 AM PDT by phoneman08
[ Post Reply | Private Reply | To 3 | View Replies]

To: 2ndDivisionVet

muslim


16 posted on 06/17/2016 3:58:20 AM PDT by rrrod (just an old guy with a gun in his pocket.l)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

...and did you know the shooter was a mooselimb who had knowledge of koran and sharia law, belief in koran and sharia law, and obediance to ignore risk to himself in order to fulfill the wishes of his moon god to kill, kill, kill, kill,.....


17 posted on 06/17/2016 4:11:41 AM PDT by Steven Tyler
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

This pretty much shows that the old man was radicalizing him from a very young age until he could be used as a tool of terror....


18 posted on 06/17/2016 4:13:37 AM PDT by trebb (Where in the the hell has my country gone?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigersEye
YouTube pulled the Fox video clip for "High School Classmate of Omar Mateen: He Cheered 9-11 Attacks"

Do you have a link to another source?

19 posted on 06/17/2016 5:18:43 AM PDT by wtd
[ Post Reply | Private Reply | To 3 | View Replies]

To: Arthur McGowan

I think it’s marksman, sharpshooter, expert.


20 posted on 06/17/2016 8:32:43 AM PDT by Arthur McGowan
[ Post Reply | Private Reply | To 10 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-30 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson