Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Artificial Intelligence Has Found an Unknown 'Ghost' Ancestor in The Human Genome
https://www.sciencealert.com ^ | 25 OCTOBER 2021 | Peter Dockrill

Posted on 11/04/2021 9:18:43 AM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 last
To: blam

interesting thx


61 posted on 11/04/2021 2:16:59 PM PDT by Chode (there is no fall back position, there's no rally point, there is no LZ... we're on our own. #FJB)
[ Post Reply | Private Reply | To 47 | View Replies]

To: Red Badger

The assumption that it all started in Africa has been growing weaker and weaker for decades in light of discovers in Asia.


62 posted on 11/04/2021 9:56:34 PM PDT by fella ("As it was before Noah so shall it be again,")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sgt_Schultze

She was involved in bringing “The Great ObamaNation” to power.


63 posted on 11/04/2021 9:58:32 PM PDT by fella ("As it was before Noah so shall it be again,")
[ Post Reply | Private Reply | To 6 | View Replies]

To: Red Badger; SunkenCiv; nuconvert; proxy_user
Here is a recent article about this (29OCT21) "Refining models of archaic admixture in Eurasia with ArchaicSeeker 2.0" More details + link to software and the data, i.e. anyone can check the results.



https://www.nature.com/articles/s41467-021-26503-5



64 posted on 11/14/2021 1:37:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Thanks AdmSmith.


65 posted on 11/14/2021 8:17:43 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 64 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson