Free Republic
Browse · Search
News/Activism
Topics · Post Article

Today, the Times of Israel also comes to McMaster’s defense

More: Why Harvey may be reassigned and why Higgins was asked to leave: https://www.theatlantic.com/politics/archive/2017/08/a-national-security-council-staffer-is-forced-out-over-a-controversial-memo/535725/?utm_source=feed

other folks: Watnick may be a witness re:Nunes, so his exit was predictable and Dahl voluntarily requested a new assignment where she could accomplish more - USAID

(and btw, I agree with the gist of Higgin's memo, just not him using govt resources to distribute it in a manner that some could interpret as an official statement)

1 posted on 08/06/2017 2:40:07 AM PDT by blueplum
[ Post Reply | Private Reply | View Replies ]


To: blueplum

There’s been a 5300% increase in the use of the hashtag “#FireMcMaster” by Russian bots and trolls. http://dashboard.securingdemocracy.org/

https://twitter.com/DarrenKaplan/status/893256889110335496

The Russians are not working for the Republican Party against the Democratic Party nor for the Democrats against the GOP, they are working against both the Republicans and the Democrats.


2 posted on 08/06/2017 3:45:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum
Since Sundance attributes the following to no one, I must conclude that he is also a supporter of McMaster:

By now most discerning political followers have identified the ideological source of the attacks against HR McMaster. A widely diverse community of domestic America-Second interests that have come together, in common ideological purpose, to attack President Trump’s National Security Advisor.

There goes Sundance from my list of smart thinkers. He is attacking me in that group, and nothing could be further from the truth. It's time for McMaster to go. Just because he gets Israel correct, does not mean he is correct on other aspects. It's time for either President Trump to wake up about him, or perhaps it is time for supporters, which includes me just for the record, to wake up about President Trump. Wake up President Trump, I am wide awake. The man may be good for one group, but he is also totally against those who are your strongest supporters because we see what he is doing to your agenda.

5 posted on 08/06/2017 4:43:10 AM PDT by Robert DeLong
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum

Sundance can be a very good analyst...but he was a HUGE supporter of “RyanCare1” and attacked those who questioned his judgement.

Use a large grain of salt when reading his opinions....


6 posted on 08/06/2017 4:45:00 AM PDT by newfreep ("If Lyin' Ted was an American citizen, he would be a traitor.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum

bump for comments


8 posted on 08/06/2017 6:27:54 AM PDT by Bob Celeste
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum

Tomorrow, the Times of Israel also comes to Hitler’s defense.


11 posted on 08/06/2017 7:40:43 AM PDT by MarvinStinson
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum

The Isreali military brass and government is anti-Israel by the way. They too have a deep swamp of crazies


12 posted on 08/06/2017 8:10:35 AM PDT by JudgemAll (Democrats Fed. job-security Whorocracy & hate:hypocrites must be gay like us or be tested/crucifiedc)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum

Sundance has lost his mind on this one. McMaster is a deluded (or worse) Islamophile, refuses to even use the term “ISIS” because he claims they are “un-Islamic” (remind you of someone named Barry?) and hired two Arab Muslims hostile to Israel into top positions: Dina Powell and former CAIR offical Mustafa Javed Ali into top NSC positions. See his disturbing speeches about Islam at the Army War College, etc for a real eye-opener. Just because weasels like Cernovich and Stone are joining the attack doesn’t mean it’s not a real concern.


13 posted on 08/06/2017 9:12:02 AM PDT by montag813 (ue)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum
Sundance uses this pic with Def Minister Lieberman as evidence that Israelis love McMaster...

Um....what about...?

sundance is full of shiite. Does anyone think Israel loved Susan Rice??

14 posted on 08/06/2017 9:16:35 AM PDT by montag813 (ue)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: dennisw; Cachelot; Nix 2; veronica; Catspaw; knighthawk; Alouette; Optimist; weikel; Lent; GregB; ..
Middle East and terrorism, occasional political and Jewish issues Ping List. High Volume

If you’d like to be on or off, please FR mail me.

..................

I doubt McMaster is anti Israel, certainly not anti semitic, but clearly pro Palestinian and supportive of the Obama Iran deal. Presumably these positions fit with the President's views. He was the one who made the decision. Like the Embassy move. Can't blame his advisors.

As to the headline, I consider it bogus. No Israeli officials are quoted. Other than an anonymous statement to Ha'aertz. For those not familiar with Ha'aertz, it's a paper far to the left of the New York Times or the Washington Post. If you are on board with anonymous leaks to the NYT or WP, then you should be on board with Ha'aertz. And should ignore radical Zionists like Caroline Glick, NSC Purge: McMaster ‘Deeply Hostile to Israel and to Trump’

My personal opinion, no question McMaster is a patriot, probably left wing politically. But if he's the President's man, that's that. At the end of the day the decisions don't belong to McMaster.

15 posted on 08/06/2017 10:08:23 AM PDT by SJackson (The Pilgrims—Doing the jobs Native Americans wouldn’t do !)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum

McMAster supports Iran and the Iran Deal


20 posted on 08/06/2017 5:38:49 PM PDT by MarvinStinson
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum
The Conservative TreeHouse should stop abusing the image of Andrew Brietbart. He would have no time for these mentally useful idiots for the left. In the real world an unnamed source never speaks for an administration, much less a country. To use this as a jumping off point to go into gross antisemitism with claims of "America-Second" and "Israel-first" isn't just being wrong. It's an objective declaration of mental illness. This putz should be writting with nothing sharper than a crayon.

MMaster has written and said nasty anti-Israel things. He's been called out for it. This antisemitic attack on those supporting him inoculates him against the truth of his pro-Islamist record and protects the traitors and knaves protecting him.

You are a few Thorazine prescriptions short of a full deck, Sundance. Stop writing articles until you understand why your article should never have been written.

22 posted on 08/07/2017 6:46:43 PM PDT by rmlew ("Mosques are our barracks, minarets our bayonets, domes our helmets, the believers our soldiers.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: blueplum; OwenKellogg; Wallaby; Sal; All

https://theconservativetreehouse.com/2017/08/07/liberal-media-and-useful-pawns-unite-to-remove-steve-bannon-from-white-house/amp/

Has this been posted here today? It’s a twist I hadn’t thought of yet. The point he’s making here is that conservatives are being played. Libs and NeverTrumpers think if they can create a big enough rift between Bannon and McMaster, then Trump will have to fire one of them to restore peace. They think Trump would be forced to let Bannon go instead of McMaster.

IOW, the theory is that all this “manufactured chaos” has absolutely nothing to do with McMaster: It’s another attempt to take out Bannon. Look up Hegelian Dialectic concept. I’m pretty sure that’s applicable here. (More on that in a minute).

Not in this article:
The thinking among many Trumplicans on twitter is that Cernovich and others are being paid to turn on McMaster to help create the chaos. (Paid or not, that guy is losing it. Anyone following him needs to pay attention before you retweet anything he posts.) Cernovich et al would be the useful stooges paid with Soros bitcoin money to help create the desired situation of an unsustainable conflict between HRM and SB.

Conservatives have sincere ideological reasons for opposing HRM, and the Dems/NeverTrumpers are allegedly using this opportunity by hiring self-promoters and twitter trolls/bot to attack McMaster. They are suspected of pretending to be conservatives, hoping the combined onslaught will create a trending “#FireMcMaster” hashtag. This would pressure Trump to act (similar to the Flynn situation).

Couple that social media onslaught with an outpouring of HRM support from Libs and NeverTrumpers, and they hope that Trump would decide he could do without Bannon easier than he could do without HRM. I’m not saying all this is accurate so don’t kill the messenger.

Someone smarter than I in philosophy could confirm or deny this as being applicable to the Hegelian Dialectic framework. You can look at this and perhaps see what I’m saying. It makes sense to me, and Dem operatives use this all the time in other areas.

http://3.bp.blogspot.com/-qxtgmMDagE0/Ui4GOFieG_I/AAAAAAAADTo/3i1IM8fSsrg/s1600/hegelian.jpg

https://redgreenalliancedotcom.files.wordpress.com/2016/04/hegelian-dialectic.jpg?w=610


23 posted on 08/07/2017 7:52:47 PM PDT by Nita Nupress (To Wash DC: America is coming. And we're bringing Galt-Right Donald J. Trump with us.)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson