Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: lee martell; Impy; dp0622; Clintonfatigued; BillyBoy

And as I’ve touched on before, most of the population of NK has been subjected to malnutrition since the ascendance of Lil’ Kim’s grandpap. It’s become such a problem that it has clearly effected brain development and even the size of the citizenry. You look at the Norks, the military people, and they look physically the size of emaciated 10-year old children playing dress-up in adult clothing.

Compared to South Koreans, the latter are well-fed, larger, taller and better mentally developed than their counterparts as their hardships and deprivations ceased after the war. If Kim was brought down today, it would be almost impossible to assimilate the present population into South Korea. The Norks would remain intellectually and physically stunted and unlikely to substantially intermix with their South cousins, who are as far removed from them across the board as imaginable. The cultural and social impact would be a disaster.

If anyone ever wanted to point to the impact a perfect, totalitarian leftist state can have on a group of citizens over a period of 70 years, North Korea is just the place. Retarded, placid and fearful, more like animals than human beings. What the left wants to do to all people (except for the ruling class, of course).


37 posted on 07/31/2016 2:41:14 AM PDT by fieldmarshaldj (Resist We Much)
[ Post Reply | Private Reply | To 20 | View Replies ]


To: fieldmarshaldj

Horrifying and accurate and an brings up facts I have never considered.

If the full light of day could shine on NK finally, what horrors would we find? What manner of people would we see on a large scale basis?

If there’s no food for adults, then there’s obviously no food for children, which would devastate development.

How does such an isolated country get the money and knowlege to build nukes and a semi decent artillery system?!?!?!

They say at night, NK is almost completley dark from the sky.


40 posted on 07/31/2016 2:49:40 AM PDT by dp0622 (The only thing an upper crust conservative hates more than a liberal is a middle class conservative)
[ Post Reply | Private Reply | To 37 | View Replies ]

To: fieldmarshaldj

It almost sounds as if the North Koreans are the asian equivalent of Aboriginines compared to the average Australian. The tragedy is the North Korean generational meltdown was knowingly caused and prolonged, while Aboriginines are that way by nature and culture. The Abs are capable of learning and many have become integrated into the larger society. Many of the North Koreans may already have irreversible brain damage, DNA damage.


79 posted on 07/31/2016 9:37:31 AM PDT by lee martell
[ Post Reply | Private Reply | To 37 | View Replies ]

To: fieldmarshaldj; thesligoduffyflynns; TigerLikesRooster

North Korea recently resumed its encrypted numbers broadcast, a method used in the past to send orders to spies in the South.

http://www.koreaherald.com/view.php?ud=20160731000297


88 posted on 07/31/2016 1:37:36 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 37 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson