Free Republic
Browse · Search
News/Activism
Topics · Post Article

I thought it would have been loaded with the cargo but this kind of makes sense.
1 posted on 11/18/2015 8:32:23 AM PST by McGruff
[ Post Reply | Private Reply | View Replies ]


To: McGruff

Probably disguised as a clock in a briefcase.


2 posted on 11/18/2015 8:34:32 AM PST by ClearCase_guy (I support anything which diminishes the Muslim population.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff

Does this validate the much-maligned video of the bombing?


3 posted on 11/18/2015 8:37:45 AM PST by ctdonath2 (History does not long entrust the care of freedom to the week or the timid. - Ike)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff

Carry on by staff or passenger ?


4 posted on 11/18/2015 8:38:34 AM PST by hoosiermama
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff

8 posted on 11/18/2015 8:41:00 AM PST by ButThreeLeftsDo (FreeRepublic needs your financial support.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff

Perhaps an ISIS terrorist posed as a beverage vendor, uniform, van and all?


16 posted on 11/18/2015 8:54:27 AM PST by CivilWarBrewing
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff

ISIS claim they bombed Russian plane using this Schweppes pineapple drinks can

Islamic State claims this picture reveals the bomb which brought down the Russian jetliner killing 224 people – disguised as a drinks can.

The image appeared in the latest edition of the extremists’ magazine Dabiq.

The edition celebrates the recent Paris attacks and is entitled ‘Just Terror’.

The magazine also claims to have images of passports belonging to victims who perished after the Metrojet flight exploded over Sinai.

It disintegrated in mid-air 23 minutes after taking off from popular tourist resort Sharm El-Sheikh in Egypt for St Petersburg on October 31.

http://www.mirror.co.uk/news/uk-news/russian-plane-crash-isis-release-6855639


21 posted on 11/18/2015 9:03:59 AM PST by wtd
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff

The photo ISIL posted made it look like a beer or soda can.

If it was stuck in a seat back, no one probably would have paid attention. Or if a maintenance guy dropped it into a toilet, no one would have seen.


24 posted on 11/18/2015 9:15:51 AM PST by Vermont Lt (I had student debt. It came from a bank. Not from the Govt.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: TXnMA

Ping.


32 posted on 11/18/2015 9:37:23 AM PST by PA Engineer (Liberate America from the Occupation Media. #2ndAmendmentMatters)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff
If you saw that soda can bomb ISIS posted photos of ..it could of been planted by the plane cleaning crew

You've ever been on a flight you know the cleaning crew comes on board right after landing....and there's all sorts of trash and debris to clean up on the floor and under seats

So one of the cleaning crew just conveniently leave the soda can bomb somewhere under the seat.. looking like forgotten trash

Lets face it the cleaning crew people are usually going to be the lowest people on the pecking order easiest job to get....

easiest path of least resistance to penetrate security, easiest vector to get in

33 posted on 11/18/2015 9:42:11 AM PST by tophat9000 (King G(OP)eorge III has no idea why the Americans Patr a in rebellion... teach him why)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff; SunkenCiv; ETL
According to Kommersant the bomb was of the same type as at the apartment bombings 1999

http://www.kommersant.ru/doc/2857174

very strange, or is it?

40 posted on 11/19/2015 4:25:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: McGruff
A little duct tape attaching the can to the front leg or bottom of an inside seat and it would be nearly invisible.

It doesn't take a lot of plastic explosive to catastrophically compromise the main structure of a pressurized aircraft at 31,000 feet traveling at over 400 knots. Tests of around 1/2 pound of explosive in an actual pressurized airliner on the ground show it is sufficient to do the job.

45 posted on 11/19/2015 6:55:16 AM PST by Gritty (The Barbarians Are Inside, And There Are No Gates. So screw the candlelight vigil. - Mark Steyn)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson