Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Anti-Vaccine Fanatics Kill
Townhall.com ^ | February 4, 2014 | Ben Shapiro

Posted on 02/04/2015 11:01:19 AM PST by Kaslin

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 261-280281-300301-320321-335 last
To: kaila

ANYONE with a child with a compromised immune system should NOT send them to a public school home school with a tutor if necessary this should be paid for by the state these parents PAY taxes also!!!!!


321 posted on 02/08/2015 11:35:00 AM PST by Kit cat (OBummer must go)
[ Post Reply | Private Reply | To 320 | View Replies]

To: FredZarguna
I want to clarify; I would not give varicella vaccine to my child- if I had one- until they were about 15-17. I would want them to get it naturally. But by the time they are in their teens, and they did not have chicken pox, then they would get the vaccine.
It is dangerous to have chicken pox as an adult. That is why I am against this vaccine, because I am afraid the effect is not as long lasting as having it naturally. As a result, we are going to have older adults die of chicken pox.
322 posted on 02/08/2015 11:37:43 AM PST by kaila
[ Post Reply | Private Reply | To 308 | View Replies]

To: Kit cat

You are right. Or a private classroom away from other kids. Measles is not the only diseases parents should worry about. Kids carry a lot more bacteria on them than virus.


323 posted on 02/08/2015 11:39:58 AM PST by kaila
[ Post Reply | Private Reply | To 321 | View Replies]

To: kaila

A father suing the school district to keep his child with leukemia safe from viruses and bacteria is ludicrous THAT’S YOUR job as a PARENT!!!!!! Some people will NEVER give up on the thought that government is the solution to ALL of our everyday problems!!!!!! He lives in CA. after all, with all of the immigrants HERE if it were my kids they would NEVER be in the CA. school system for MANY reasons!!!!!!!


324 posted on 02/08/2015 12:13:35 PM PST by Kit cat (OBummer must go)
[ Post Reply | Private Reply | To 323 | View Replies]

To: kaila

A father suing the school district to keep his child with leukemia safe from viruses and bacteria is ludicrous THAT’S YOUR job as a PARENT!!!!!! Some people will NEVER give up on the thought that government is the solution to ALL of our everyday problems!!!!!! He lives in CA. after all, with all of the immigrants HERE if it were my kids they would NEVER be in the CA. school system for MANY reasons!!!!!!!


325 posted on 02/08/2015 12:28:55 PM PST by Kit cat (OBummer must go)
[ Post Reply | Private Reply | To 323 | View Replies]

To: FredZarguna

vaccinated children or vaccine virus strains pose the same risk of virus mutations as wild viruses the big difference is that while an unvaccinated child may or may not get a specific virus all the vaccinated ones (live virus vaccines- MMR, chicken pox, oral polio,flu etc) have the same potential to contribute to virus mutations and they have.
read this
http://www.cdc.gov/mmwr/preview/mmwrhtml/mm54d1014a1.htm

you can also find articles about measles vaccine virus shading for more then 4 weeks after MMR shot or also search atipical measels


326 posted on 07/15/2015 2:38:28 AM PDT by Greg67
[ Post Reply | Private Reply | To 259 | View Replies]

To: Greg67
The article you're citing makes the case for vaccination. It shows why herd immunity is important. The index patient is immunocompromised and would not have been exposed to the virus in a community where there was widespread vaccination.
327 posted on 07/15/2015 5:14:28 AM PDT by FredZarguna (Now, which is bigger, Pluto or Goofy?)
[ Post Reply | Private Reply | To 326 | View Replies]

To: Greg67
have the same potential to contribute to virus mutations and they have.

You need to read the article. That is EXACTLY the opposite of what it says.

328 posted on 07/15/2015 5:17:11 AM PDT by FredZarguna (Now, which is bigger, Pluto or Goofy?)
[ Post Reply | Private Reply | To 326 | View Replies]

To: Greg67
From the article, completely demolishing your claim:

VDPVs emerge from OPV viruses as a result of 1) their continuous replication in immunodeficient persons (immunodeficiency-associated or iVDPVs) such as the index patient in this investigation or 2) their circulation in populations with low vaccination coverage (circulating or cVDPVs) (1). During community circulation, cVDPVs often recombine with other species C enteroviruses, which is not characteristic for iVDPVs (1). Because polioviruses accumulate nucleotide changes at a constant rate of mutation (approximately 1% per year), the time of replication can be inferred from the degree of divergence (1). Because cVDPVs commonly revert to a wild poliovirus phenotype, they can have increased transmissibility and high risk for paralytic disease; cVDPVs have caused outbreaks of poliomyelitis in several countries (1). VDPVs in highly immunized populations are rare. Before the VDPV identification in Minnesota, the most recent known VDPV excreter in the United States was a child with SCID (now deceased) who developed vaccine-associated paralytic poliomyelitis in 1995 (4).

329 posted on 07/15/2015 5:21:20 AM PDT by FredZarguna (Now, which is bigger, Pluto or Goofy?)
[ Post Reply | Private Reply | To 326 | View Replies]

To: FredZarguna
you are buying the propaganda all such articles are full of them on order to deflect any other cause.
While the article establishes the source, a vaccine strain virus and the rate of mutations for it, have you seen the science where it says that only immunodeficient persons have the virus and only they are contributing to those mutations and shading of it?
Is just a claim and is a bad one even if was true because the more you vaccinate more immunodeficient persons are getting the shot and/or be exposed to the Vaccine strain of the virus and will mutate viruses and some of the mutations may end up affecting many more vaccinated or not.
As this crap statement from the article.....
“their circulation in populations with low vaccination coverage”

lets see what low vaccination coverage means
a mix of vaccinated and vaccinated persons on whatever ratio you like
BUT
Unvaccinated ones need to get the VACCINE STRAIN VIRUS (mutated or not) from a vaccinated person as first source of infection .....but according to them only a immunodeficient (”and vaccinated in at least the first case” they don't add that) person propagate the virus mutated or not...
so the entire sentence about low coverage areas is pointless and meaningless unless not only immunodeficient persons can propagate the vaccine virus mutated or not....and in that case the first sentence is useless

330 posted on 07/23/2015 5:11:06 AM PDT by Greg67
[ Post Reply | Private Reply | To 329 | View Replies]

To: FredZarguna

that’s the first case the index person is not listed is the one that infected that first immunodeficient patient and she become source for the other 3 or you think vaccine strain viruses are running wild in environment because that’s even worse


331 posted on 07/23/2015 5:14:59 AM PDT by Greg67
[ Post Reply | Private Reply | To 327 | View Replies]

To: Kaslin; All

This is a little off topic, but not too much. I’m an older guy who is recovering from illness. As a result, I have become enmeshed in the medico-industrial complex. I went from not seeing a doctor for 20 years to having more doctors than I can remember. I’m accumulating doctors faster than a boat accumulates barnacles. In any event, the medicos are pushing a number of vaccines on me. Hepatitis B, pneumonia, to start. I’m not sure what else in the foreseeable future. I’m a 55 year-old guy with now-regular contact with doctors and such. Any opinions on which vaccines I should accept and which I should defer?


332 posted on 07/23/2015 5:22:08 AM PDT by sitetest (If Roeas is not overturned, no unborn child will ever be protected in law.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: sitetest

I am a senior citizen and when my husband was still in the Service and we went overseas, or back to the states we always had to get our shots updated. I had the measles and the mumps as a child, so I was covered for that. I got the Pneumonia shot a few years ago, but will not require another one because I am over the age of 70. I will be 74 in a few weeks. You on the other hand will probably require more shots.


333 posted on 07/23/2015 5:35:38 AM PDT by Kaslin (He needed the ignorant to reelect him, and he got them. Now we all have to pay the consequenses)
[ Post Reply | Private Reply | To 332 | View Replies]

To: FredZarguna
Also notice how in the article the vacc or unvacc status of the other 3 that had got infected is not stated also how ill they got or if immunodeficient or not

and yes the source of infection for that first case may had been also an unvaccinated person that is not immunodeficient

But the fact stands, it is a Vaccine strain Virus that it's source is a vaccinated person that infected those children and other regardless if their parents didn't vaccinated them or they are children immunodeficient that cant be vaccinated to begin with
so they can claim that is the vaccine that gave the illness to their immunodeficient child similar with the claims and accusations of unvacinated children infecting immunodeficient children with wild viruses

334 posted on 07/23/2015 5:42:06 AM PDT by Greg67
[ Post Reply | Private Reply | To 328 | View Replies]

To: Reno89519; SunkenCiv
I am sorry, but what could be stupider than NOT getting kids vaccinated?

True.


335 posted on 05/19/2016 4:37:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 261-280281-300301-320321-335 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson