Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

North Korea: No ‘physical reaction’ to new film
WP ^ | December 24, 2014

Posted on 12/24/2014 9:40:30 PM PST by TigerLikesRooster

North Korea: No ‘physical reaction’ to new film

By Associated Press December 24 at 5:21 PM

UNITED NATIONS — North Korea says it likely will have no “physical reaction,” just condemnation, to the release of the comedy film “The Interview,” which depicts the assassination of leader Kim Jong Un.

A North Korea diplomat to the United Nations told The Associated Press on Wednesday that his country opposes the film’s release online and in over 300 U.S. theaters this week.

(Excerpt) Read more at washingtonpost.com ...


TOPICS: Foreign Affairs; News/Current Events; War on Terror
KEYWORDS: hacking; nkorea; northkorea; obamaforeignpolicy; sony; theinterview; youtubevideo
Navigation: use the links below to view more comments.
first 1-2021-31 next last
N. Korean reaction suddenly turns lame.
1 posted on 12/24/2014 9:40:31 PM PST by TigerLikesRooster
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; endthematrix; ...

P!


2 posted on 12/24/2014 9:40:57 PM PST by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

The majority (99%) of North Koreans have no idea who Sony is or their movie or what a theater is. Most North Koreans live in a world shaped by state propaganda and are molded and shaped by it. Independent thinking gets people killed in North Korea — provided the state needs a reason.


3 posted on 12/24/2014 9:46:36 PM PST by MasterGunner01
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

> N. Korean reaction suddenly turns lame.

Kim Jong Un had his porn access cut off by the U.S. after blowing off his mouth and he no happy....


4 posted on 12/24/2014 9:49:18 PM PST by jsanders2001
[ Post Reply | Private Reply | To 1 | View Replies]

To: MasterGunner01

I saw a fascinating story on how popular culture (mainly South Korean) is smuggled into North Korea. Smugglers bring in dvd players, dvds, etc. Young people in the north are starting to become aware that there is a much better world outside.


5 posted on 12/24/2014 9:52:41 PM PST by lacrew
[ Post Reply | Private Reply | To 3 | View Replies]

To: TigerLikesRooster

An elaborate publicity stunt arranged after Sony rejected the initial ‘version’ of the film and forced Rogan and crew into rewrites/edits.

Even so, the movie is on par with similar movies by Rogan and Franco. Outrageous, obscene, and yet hilarious. As usual, a proclivity for homosexual references and rantings.

The beginning sequence with EMINEM was great, especially for those who listen to EMINEM all the time.

Overall, it was pretty good. I don’t want to give away the rest to those who plan to watch but haven’t seen it yet.


6 posted on 12/24/2014 9:56:06 PM PST by UCANSEE2 (Lost my tagline on Flight MH370. Sorry for the inconvenience.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: UCANSEE2
You can't understand 50% of dialogs if you don't know gay stuffs.
7 posted on 12/24/2014 10:00:57 PM PST by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 6 | View Replies]

To: lacrew
Smuggling from Hong Kong to Mainland China was also very big in Cold War days. It was very dangerous and those who did were often caught and sent to prison or killed. Same thing in North Korea, I'd bet...until the NorK authorities get a piece of the action. Once the bribes go down, contraband comes into the North.
8 posted on 12/24/2014 10:03:47 PM PST by MasterGunner01
[ Post Reply | Private Reply | To 5 | View Replies]

To: TigerLikesRooster; GeronL; MeshugeMikey

9 posted on 12/24/2014 10:11:55 PM PST by a fool in paradise (Shickl-Gruber's Big Lie gave us Hussein's Un-Affordable Care act (HUAC).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

They should make a silly film too.

I heard this guy executed his uncle using 120 dogs.

Now that’s funny right there.


10 posted on 12/24/2014 10:14:59 PM PST by Rome2000 (SMASH THE CPUSA)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

This is a bad movie. I stopped at 35 minutes. I have no desire to be 13 years old again.


11 posted on 12/24/2014 10:17:32 PM PST by Dallas59
[ Post Reply | Private Reply | To 1 | View Replies]

To: MasterGunner01
until the NorK authorities get a piece of the action. Once the bribes go down, contraband comes into the North.

This has been going on for some time. It reached its peak in mid-2000's. Smuggling networks were established which could reach deep inland. Party officials and soldiers lived off bribe and looked the other way. It was widespread. Feel threatened, Kim Jong-il started crackdown hard. However, once the storm passes, they grew up again. It has been going back and forth since then. Kim Jong-un has been cracking down hard on smuggling or unsanctioned(illegal) trade, while he encourages state-sanctioned slave labor trade.

12 posted on 12/24/2014 10:20:16 PM PST by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 8 | View Replies]

To: TigerLikesRooster

That could be a movie review being written right now, No Physical Reaction.


13 posted on 12/24/2014 11:04:16 PM PST by lee martell
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

I bet that is what Jong Un’s wife says to him that he is all hat and no cattle.


14 posted on 12/24/2014 11:35:14 PM PST by miele man
[ Post Reply | Private Reply | To 1 | View Replies]

To: Rome2000

The dog story was a figment of someone’s imagination. Reputable reports believe Uncle Jang was dispatched via machine gun.


15 posted on 12/24/2014 11:37:53 PM PST by miele man
[ Post Reply | Private Reply | To 10 | View Replies]

To: TigerLikesRooster; SunkenCiv; gandalftb; Tailgunner Joe; lodi90; Greetings_Puny_Humans
Is it certain that it was NK:

On Wednesday, one alternate theory emerged. Computational linguists at Taia Global, a cybersecurity consultancy, performed a linguistic analysis of the hackers’ online messages — which were all written in imperfect English — and concluded that based on translation errors and phrasing, the attackers are more likely to be Russian speakers than Korean speakers.
http://bits.blogs.nytimes.com//2014/12/24/new-study-adds-to-skepticism-among-security-experts-that-north-korea-was-behind-sony-hack/

Read this http://20committee.com/2014/12/23/beware-putins-special-war-in-2015/

16 posted on 12/25/2014 2:17:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith
By the way, didn't the perps(GOP) promise that there will be more data dump if Sony releases the movie? Sony changed its mind and the movie is available at theaters and online. So what would they do? Make good on the promise or eat their words?

If NK is not involved, I suspect the perps will respond.

17 posted on 12/25/2014 2:26:20 AM PST by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 16 | View Replies]

To: TigerLikesRooster
Time will tell.

BTW the report was done very fast

“Looking for linguists/translators with native-level German, Russian, Chinese, Korean, or Thai for an urgent project. Can you help? Pls RT!”

https://twitter.com/ShlomoArgamon/status/547446667864444928

Excellent work!

18 posted on 12/25/2014 2:47:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: miele man

The little riceball just blinked.


19 posted on 12/25/2014 4:55:53 AM PST by elcid1970 ("I am a radicalized infidel.")
[ Post Reply | Private Reply | To 14 | View Replies]

To: Rome2000; MeshugeMikey
They should make a silly film too.

Obama lives with his mother-in-law. That right there is comedy gold.

He recently saw fit to pose for a photo in a tiera.

Hollywood won't make that film, so may NoKo should?

20 posted on 12/25/2014 5:26:52 AM PST by a fool in paradise (Shickl-Gruber's Big Lie gave us Hussein's Un-Affordable Care act (HUAC).)
[ Post Reply | Private Reply | To 10 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-31 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson