Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

ISIS militants 'kill 300 MORE Yazidi men and kidnap their families on second day of massacre'
Daily Mail ^ | 17:39 EST, 16 August 2014

Posted on 08/16/2014 3:57:26 PM PDT by Dave346

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-33 last
To: Dave346

they were so much safer not having personal firearms against their muslim jihadi attackers.

libtards, sleep well tonite.


21 posted on 08/16/2014 5:31:09 PM PDT by Secret Agent Man ( Gone Galt; Not averse to Going Bronson.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dave346

Just answering the question, “What would Mohamed do?”


22 posted on 08/16/2014 5:33:25 PM PDT by SampleMan (Feral Humans are the refuse of socialism.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...
Thanks Dave346. Pat Buchanan:
Last week, we were told there were 40,000 Yazidis on Sinjar Mountain facing starvation if they remained there, and slaughter by ISIS if they came down. But a team of Marines and Special Forces that helicoptered in has reported back that, with a corridor off the mountain opened up by U.S. air strikes, the humanitarian crisis is over. The few thousand who remain can be airdropped food and water. The rest can be brought out. The emergency over...
Related.
23 posted on 08/16/2014 5:33:41 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: Dave346

Well, if all that is left are ISIS folks, then it would be OK to drop a MOAB. Not like they will kill innocent bystanders.


24 posted on 08/16/2014 5:38:16 PM PDT by Vermont Lt (If you want to keep your dignity, you can keep it. Period........ Just kidding, you can't keep it.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dave346

Unpossible, Øbama said they were safe.


25 posted on 08/16/2014 5:41:00 PM PDT by NonValueAdded ("Kerry, as Obama's plenipotentiary, is a paradox - the physical presence of a geopolitical absence")
[ Post Reply | Private Reply | To 1 | View Replies]

To: NormsRevenge

Not to worry. They will be given to jihadists and used aainst us.


26 posted on 08/16/2014 6:23:54 PM PDT by mcshot (..."And this too shall pass.")
[ Post Reply | Private Reply | To 8 | View Replies]

To: Dave346
The comment I posted on the Daily Mail. We'll see if it gets past the mods.

When the military dictators in Burma changed their name to Myanmar, the world's reporters called them Myanmar. Ditto Congo/Zaire. Now the Muslim fanatics in Syria and Iraq are calling themselves the Islamic State. Why are reporters still calling them by the outdated term ISIS? They are the Islamic State, or the Islamic Caliphate. What are Western reporters afraid of revealing? That the distilled essence of the most devout practice of Koranic Sharia Islam is being revealed today in Iraq for the world to see. The ROE or rules of engagement of the Islamic State are: Behead the men, enslave and rape the women, and all in accordance with their close reading of the Koran. And where are the mass demonstrations of the world's "moderate" Muslims against the barbaric outrages of the Islamic State? Nowhere. Instead, we hear crickets. A note to "moderate" Muslims: Your silence equals consent.

27 posted on 08/16/2014 6:31:40 PM PDT by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dave346

Send in the French. Bammy cares not.


28 posted on 08/16/2014 6:41:09 PM PDT by MarMema (Run Ted Run)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mcshot

I see your faith in the Republic and Mom and apple pie is as strong as mine. :-)

Just ask for lactose gluten free ice cream on top.. Of the apple pie, not Mom!


29 posted on 08/16/2014 6:50:35 PM PDT by NormsRevenge (Semper Fi - Revolution is a'brewin!!!)
[ Post Reply | Private Reply | To 26 | View Replies]

To: MarMema

Where is the Foreign Legion? I was going to ask that earlier.

Already over committed chasing malcontents on the borders of African countries where Christians are massacred enmasse?

I don’t think so.

Too bad someone like Ross Perot didn’t setup a Book Harum relief effort,, to relieve all them fellars of having to breathe anymore,,

Coddling murderers is no way to defend the locals and, eventually, the regimes that reside over the worst Africa has to offer.

So full of promise, so devoid of humanity.


30 posted on 08/16/2014 6:55:28 PM PDT by NormsRevenge (Semper Fi - Revolution is a'brewin!!!)
[ Post Reply | Private Reply | To 28 | View Replies]

To: SampleMan
“What would Mohamed do?”

Probably massacre any remaining Yazidis in retaliation for the airstrikes and then blow up the Mosul Dam if the Kurds don't back off.

31 posted on 08/16/2014 8:55:58 PM PDT by mikey_hates_everything
[ Post Reply | Private Reply | To 22 | View Replies]

To: mikey_hates_everything; SampleMan
Part of the answer is that the West is in the grip of theological illiteracy. It has stubbornly refused to grasp the implications of a global Islamic revival which has been gaining steam for the best part of a century. The Islamic Movement looks back to the glory days of conquest as Islam's finest hour, and seeks to revive Islamic supremacy through jihad and sacrifice. It longs for a truly Islamic state – the caliphate reborn – and considers jihad to be the God-given means to usher it in.

This worldview was promoted in compelling, visionary terms by Indian scholar Abul A’la Maududi, whose writings continue to be widely disseminated by Islamic bookshops and mosques across the West. Maududi argued in his radicalisation primer Let us be Muslims that the only valid form of government is Islamic theocracy – i.e. sharia rule – and Muslims are duty-bound to use whatever power they can muster to impose this goal on the world: ‘whoever you are, in whichever country you live, you must strive to change the wrong basis of government, and seize all powers to rule and make laws from those who do not fear God. … The name of this striving is jihad.’ And ‘If you believe Islam to be true, you have no alternative but to exert your utmost strength to make it prevail on earth: you either establish it or give your lives in this struggle.’


The treatment of captives by IS is also in accordance with orthodox rules of war in Islam, which permit men to be killed, while women and children are enslaved. Sex slavery – concubinage – is permitted by the sharia principles which guide IS. The Reliance of the Traveller – a respected Sunni manual of sharia law – states: ‘When a child or a woman is taken captive, they become slaves by the fact of capture, and the woman's previous marriage is immediately annulled’ (chapter o9.13). The option of converting to Islam to avoid death or capture – which is being urged upon non-Muslims by IS – is also clearly supported: ‘Whoever enters Islam before being captured may not be killed or his property confiscated, or his young children taken captive’ (chapter o9.12).


The widespread looting of property is also validated by Islam's rules of war: ‘A free male Muslim who has reached puberty and is sane is entitled to the spoils of battle when he has participated in a battle to the end of it’ (chapter o10.1). And ‘Anyone who … kills one of the enemy or effectively incapacitates him, risking his own life thereby, is entitled to whatever he can take from the enemy, meaning as much as he can take away with him in the battle, such as a mount, clothes, weaponry, money or other’ (chapter o10.2).


The grim reality is that the fate of Christians and Yazidis in northern Iraq today all too often matches the stipulations of Islamic textbooks: non-Muslim men are killed, their women and children enslaved, and their property and possessions looted.


http://www.meforum.org/4774/islam-genocide-middle-east

32 posted on 08/17/2014 1:01:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Dave346

33 posted on 08/17/2014 1:04:09 AM PDT by Fresh Wind (The last remnants of the Old Republic have been swept away.)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-33 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson