Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Saudi Arabia widens crackdown on women's rights activists
BBC News ^ | 5/23/2018 | BBC

Posted on 05/23/2018 5:57:12 AM PDT by Spiridon

Saudi Arabia has reportedly arrested three more women's rights activists in a crackdown launched just weeks before a ban on women driving will be lifted.

Human rights groups said at least 10 people, most of them women who had long campaigned for the right to drive, had now been detained since last week.

Officials have said they are suspected of "suspicious contact with foreign parties" and "undermining "stability".

Other activists have said the crackdown is "unprecedented" and "shocking".......

(Excerpt) Read more at bbc.com ...


TOPICS: Extended News; Foreign Affairs
KEYWORDS: donaldtrump; iran; saudiarabia; spiritroll; trollidon
Navigation: use the links below to view more comments.
first 1-2021-4041-53 next last
Because Iran is a horrible theocracy that oppresses women we need to be on the side of Saudi Arabia, which claims to be "reforming".

This notion was played out in President Trump's visit to Saudi Arabia last year.

I think not.

They are above all the home of jihad in Libya and now Syria in recent years. Also the spiritual heartland of the 9/11 terrorists-Al Qaeda plus the homeland of most of the 9/11 terrorists.

The Deep State leads President Trump down the wrong path of supporting Islamic Brand A over Islamic Brand B.

1 posted on 05/23/2018 5:57:12 AM PDT by Spiridon
[ Post Reply | Private Reply | View Replies]

To: Spiridon

Which is like choosing who to support, Nazis or Communists?

Answer: None of the above.


2 posted on 05/23/2018 5:59:55 AM PDT by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Spiridon

Crickets from the Feminazis here.


3 posted on 05/23/2018 7:17:26 AM PDT by Buckeye McFrog
[ Post Reply | Private Reply | To 1 | View Replies]

To: Spiridon

Interesting timing considering this Drudge article, since it was his initiative that was opening up SA society.

https://usa.spectator.co.uk/2018/05/are-the-reports-of-mohammed-bin-salmans-death-greatly-exaggerated/

Are reports of Mohammed bin Salman’s death greatly exaggerated?


4 posted on 05/23/2018 7:21:49 AM PDT by mairdie
[ Post Reply | Private Reply | To 1 | View Replies]

To: Spiridon

There was a rumor (posted on Drudge) that the new Crown Prince(MBS), who was liberalizing Saudi Arabia, was killed, wounded or sidelined, after an outbreak of small arms fire at his palace on 21 April:

https://usa.spectator.co.uk/2018/05/are-the-reports-of-mohammed-bin-salmans-death-greatly-exaggerated/

This crackdown on reformers who advocated letting women drive have been arrested, is a seeming reaction to MBS’ recent reforms. It is not yet clear if the modernization drive is over.

King Faisal was assassinated by a family member for being to liberal (allowing TV broadcasting). After that, Saudi Arabia became worse. MBS was taking big risks by making bold reforms.

Things are always opaque in Saudi Arabia, an absolute dictatorship Police State.


5 posted on 05/23/2018 7:26:02 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1 | View Replies]

To: Buckeye McFrog

Where at the George and Amal Clooney’s on this?

They are moneyed by the elites that get the money from Gulf Arabs like the Saudis.

There’s plenty of foreign cash in Hollywood in general and the Saudi Crown Prince visited the Left Coast on his “goodwill tour” earlier this year.


6 posted on 05/23/2018 8:08:58 AM PDT by Nextrush (Freedom is everybody's business: Remember Pastor Niemoller)
[ Post Reply | Private Reply | To 3 | View Replies]

To: FreedomPoster

President Trump has decided to go the route of the long term relationship with the Saudis it appears with his big visit last year and pledges of Saudi dollars being used to buy weapons from the USA and Saudi bucks being invested here in the USA.

It means hostility to Iran and one wonders where that ends up.

Will the “Persian Spring” be the new “Arab Spring” by this time next year?

A newer bigger Syrian situation on the map?


7 posted on 05/23/2018 8:28:40 AM PDT by Spiridon
[ Post Reply | Private Reply | To 2 | View Replies]

To: Spiridon

You could make the argument that it makes sense to side with the Saudis, for now, due to Iran’s ongoing development of nuclear weapons and delivery systems, which must be stopped. And there is the fact that the new KSA Crown Prince, Mohammad bin Salman, seems to be taking action to reign in the Wahabi factions.

That said, long term they are still our enemies.


8 posted on 05/23/2018 8:45:21 AM PDT by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 7 | View Replies]

To: FreedomPoster

Actually, long term, SaudiArabia is a staunch ally.

Ditto the GCC


9 posted on 05/23/2018 8:46:59 AM PDT by bert ((K.E. N.P. N.C. +12 ..... Greetings Jacques. The revolution is coming))
[ Post Reply | Private Reply | To 8 | View Replies]

To: bert
The title sounds like a sexist attack on women!

Saudi Arabia widens crackdown on women's rights activists!"

10 posted on 05/23/2018 10:41:38 AM PDT by Grampa Dave (Democrats are having trouble with their MAMA campaign, (Make America Mexico Again), versus MAGA!)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Spiridon

Saudi Arabia:
Saudi Arabia Is About To Behead 6 School Girls For Acting ‘Indecently’ With Their Male Friends (link: http://www.cvikas.com/2018/05/19/saudi-arabia-is-about-to-behead-6-school-girls-for-acting-indecently-with-their-male-friends/)

Those women drivers may face execution.
(link: https://www.zerohedge.com/news/2018-05-21/saudi-womens-driving-activists-accused-running-spy-cell-could-face-execution)

These KSA barbarians are not my ally.


11 posted on 05/23/2018 12:08:01 PM PDT by sockmonkey (I am an America First, not Israel First FReeper.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: bert

*** Actually, long term, SaudiArabia is a staunch ally.

Ditto the GCC ***

Please see my post #11. With friends like the Saudis, who needs enemies.


12 posted on 05/23/2018 12:10:45 PM PDT by sockmonkey (I am an America First, not Israel First FReeper.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Spiridon

“suspicious contact with foreign panties”

Yep, been there done that.


13 posted on 05/23/2018 12:13:10 PM PDT by tet68 ( " We would not die in that man's company, that fears his fellowship to die with us...." Henry V.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Spiridon; SunkenCiv; caww; nuconvert; TigerLikesRooster; gandalftb; Dog; Boot Hill; swarthyguy; ...
This is most likely an indication that MbS no longer is in full control.

An exiled Saudi prince has called for a coup by his influential uncles to depose King Salman and prevent the current ruling structure led by his son, Crown Prince Mohammed bin Salman, from doing more damage to the kingdom.

Prince Khaled bin Farhan, who has been awarded asylum in Germany, made the call on Prince Ahmed bin Abdulaziz and Prince Muqrin bin Abdulaziz in comments to the Middle East Eye news portal published on Monday.

https://muraselon.com/en/2018/05/saudi-royal-urges-coup-to-depose-king-salman-protect-kingdom-from-harm/

In a few days we will know what is happening in KSA.

14 posted on 05/24/2018 2:40:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

http://www.middleeasteye.net/news/transcript-interview-Prince-Khaled-bin-Farhan-Saudi-Arabia-726162742


15 posted on 05/24/2018 2:48:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith
My opinion is that the coup won't happen now, while King Salman is on the throne. MbS may be the real power, but Salman's generation will not want to rock the boat while Salman is the figurehead

So MbS is hurriedly trying to get everything and everyone on his side. And the cousins know that if they wait it may be too late

16 posted on 05/24/2018 2:58:43 AM PDT by Cronos (Obama's dislike of Assad is not based on his brutality but that he isn't a jihadi Moslem)
[ Post Reply | Private Reply | To 14 | View Replies]

To: bert
The Sauds taught the Taliban, AlQaeda, Boko haram etc. - with the spreadof Wahabbism using Saudi money. They are the enemy.

Nearly all of the 911 terrorists were Saudis

17 posted on 05/24/2018 3:00:58 AM PDT by Cronos (Obama's dislike of Assad is not based on his brutality but that he isn't a jihadi Moslem)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

It’s always the beardos with the halitosis that are called “reformers,” when they call for reactionary regression. Impossible problem. Everyone thought Ataturk had solved the problem, but here it pops back up again, and Turkey’s on its way back to the dark ages again.


18 posted on 05/24/2018 3:13:56 AM PDT by Eleutheria5 (“If you are not prepared to use force to defend civilization, then be prepared to accept barbarism.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith
Yeah, they can even cut back-channel deals with their devils, Iranians.
On the other hand, if liberalization is moving too fast, it won't be good for MbS either. It could invite popular backlash. He may be a reformer, but not keen on certified liberals running wild in his country. He should present himself as moderate and pragmatic, not another ideologue on the other end of political spectrum. He should let women drive, but not go so far as to tolerate radical feminism.
19 posted on 05/24/2018 3:16:19 AM PDT by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith
I think a realistic goal is to turn a Saudi King into somebody like Mubarak, a less religious and more secular dictator.
20 posted on 05/24/2018 3:20:24 AM PDT by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 14 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-53 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson